Incidental Mutation 'R8701:Or51r1'
ID 669070
Institutional Source Beutler Lab
Gene Symbol Or51r1
Ensembl Gene ENSMUSG00000073975
Gene Name olfactory receptor family 51 subfamily R member 1
Synonyms GA_x6K02T2PBJ9-5297243-5298193, Olfr550, MOR16-1
MMRRC Submission 068555-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R8701 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102220638-102228869 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102227899 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 66 (M66L)
Ref Sequence ENSEMBL: ENSMUSP00000149536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098225] [ENSMUST00000213540] [ENSMUST00000216524]
AlphaFold E9Q544
Predicted Effect possibly damaging
Transcript: ENSMUST00000098225
AA Change: M66L

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095828
Gene: ENSMUSG00000073975
AA Change: M66L

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 6.2e-102 PFAM
Pfam:7TM_GPCR_Srsx 36 156 1.8e-10 PFAM
Pfam:7tm_1 42 293 4.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213540
Predicted Effect possibly damaging
Transcript: ENSMUST00000216524
AA Change: M66L

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,836,785 (GRCm39) I659V probably benign Het
Adamtsl4 T A 3: 95,592,276 (GRCm39) D24V possibly damaging Het
Agtr1b A T 3: 20,370,256 (GRCm39) F117I probably damaging Het
Aldh3b2 A G 19: 4,028,448 (GRCm39) E116G probably damaging Het
Alox5 T A 6: 116,390,787 (GRCm39) I455F possibly damaging Het
Arnt C T 3: 95,401,076 (GRCm39) S675F possibly damaging Het
Camkv A G 9: 107,825,240 (GRCm39) T414A possibly damaging Het
Ccn5 G T 2: 163,670,786 (GRCm39) G98W probably damaging Het
Cd209c C T 8: 3,995,892 (GRCm39) R6H probably benign Het
Cip2a T A 16: 48,827,504 (GRCm39) Y456* probably null Het
Cnr1 A G 4: 33,944,739 (GRCm39) I376V probably benign Het
Cyp2j12 T A 4: 96,009,810 (GRCm39) K183M possibly damaging Het
Dact3 G T 7: 16,619,201 (GRCm39) R232L probably damaging Het
Dlg5 G A 14: 24,226,768 (GRCm39) T378M probably benign Het
Dnah10 T A 5: 124,803,911 (GRCm39) D79E probably benign Het
Dsc1 A T 18: 20,240,739 (GRCm39) Y195* probably null Het
Elovl1 A T 4: 118,287,707 (GRCm39) M1L probably benign Het
Fam107a A G 14: 8,298,755 (GRCm38) F124L probably damaging Het
Fam219a A G 4: 41,520,283 (GRCm39) M155T probably damaging Het
Gm28308 C G 6: 52,140,430 (GRCm39) probably benign Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gtf2ird2 T A 5: 134,245,077 (GRCm39) I445N probably damaging Het
Gzmb A T 14: 56,497,817 (GRCm39) V141E probably benign Het
Hmcn1 A T 1: 150,631,008 (GRCm39) M930K probably benign Het
Hunk T A 16: 90,183,498 (GRCm39) F52Y probably damaging Het
Il18rap A G 1: 40,578,501 (GRCm39) E304G probably benign Het
Klk14 A G 7: 43,343,566 (GRCm39) S133G possibly damaging Het
Man2b1 T C 8: 85,821,782 (GRCm39) S695P probably damaging Het
Mccc1 A T 3: 36,049,933 (GRCm39) D86E probably benign Het
Mcu T A 10: 59,303,475 (GRCm39) I121F probably damaging Het
Mlxipl T C 5: 135,136,045 (GRCm39) F90S possibly damaging Het
Muc2 A G 7: 141,281,850 (GRCm39) D536G probably damaging Het
Naa11 T C 5: 97,539,817 (GRCm39) S114G possibly damaging Het
Ncaph T C 2: 126,948,058 (GRCm39) K676E probably benign Het
Neurl2 C T 2: 164,675,054 (GRCm39) D103N probably benign Het
Nup210l T C 3: 90,030,121 (GRCm39) M278T probably benign Het
Or10g6 A G 9: 39,933,815 (GRCm39) N42S probably damaging Het
Or4p4 A G 2: 88,482,831 (GRCm39) I112V possibly damaging Het
Or8c19-ps1 A T 9: 38,220,734 (GRCm39) L214F unknown Het
Or8g4 A T 9: 39,662,210 (GRCm39) H176L probably damaging Het
Pcdh20 A T 14: 88,705,849 (GRCm39) Y484N possibly damaging Het
Pkhd1l1 A G 15: 44,438,079 (GRCm39) Y3598C probably damaging Het
Plcg2 T A 8: 118,308,416 (GRCm39) L336Q probably damaging Het
Ppp1r8 T C 4: 132,557,953 (GRCm39) D207G possibly damaging Het
Prdm13 C T 4: 21,678,615 (GRCm39) C625Y probably damaging Het
Ptcd3 T C 6: 71,862,495 (GRCm39) D480G possibly damaging Het
Rbm39 T A 2: 156,003,507 (GRCm39) K291M probably damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rnf220 T C 4: 117,347,190 (GRCm39) H74R probably damaging Het
Sp6 A T 11: 96,913,090 (GRCm39) T268S probably damaging Het
Spata31e2 A T 1: 26,724,526 (GRCm39) V218D probably benign Het
Sphk2 A T 7: 45,360,249 (GRCm39) V585E probably damaging Het
Syne1 G A 10: 5,155,026 (GRCm39) Q5638* probably null Het
Tas1r3 C T 4: 155,945,503 (GRCm39) V573I probably benign Het
Tdrd1 T C 19: 56,839,916 (GRCm39) S659P possibly damaging Het
Tead4 T A 6: 128,219,529 (GRCm39) K237N probably damaging Het
Tex24 T A 8: 27,835,152 (GRCm39) C227S probably benign Het
Tom1 A T 8: 75,778,796 (GRCm39) T174S probably benign Het
Tpm3 C T 3: 89,994,987 (GRCm39) R168C possibly damaging Het
Trpv3 A G 11: 73,169,762 (GRCm39) E111G possibly damaging Het
Unc80 A G 1: 66,677,191 (GRCm39) D2040G possibly damaging Het
Usp47 A G 7: 111,692,402 (GRCm39) T955A probably damaging Het
Vmn2r11 G A 5: 109,195,556 (GRCm39) A590V probably damaging Het
Zfp112 A G 7: 23,825,165 (GRCm39) R382G probably damaging Het
Zfp606 T A 7: 12,215,025 (GRCm39) D84E unknown Het
Other mutations in Or51r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01946:Or51r1 APN 7 102,227,734 (GRCm39) splice site probably null
IGL02605:Or51r1 APN 7 102,228,602 (GRCm39) missense probably damaging 1.00
IGL03365:Or51r1 APN 7 102,227,836 (GRCm39) missense probably benign
R0180:Or51r1 UTSW 7 102,228,239 (GRCm39) missense probably damaging 1.00
R3854:Or51r1 UTSW 7 102,228,227 (GRCm39) missense probably damaging 1.00
R5337:Or51r1 UTSW 7 102,228,481 (GRCm39) missense probably damaging 1.00
R5606:Or51r1 UTSW 7 102,228,481 (GRCm39) missense probably damaging 1.00
R5646:Or51r1 UTSW 7 102,228,512 (GRCm39) missense possibly damaging 0.84
R6009:Or51r1 UTSW 7 102,227,801 (GRCm39) missense possibly damaging 0.86
R6751:Or51r1 UTSW 7 102,227,706 (GRCm39) start codon destroyed probably null
R7767:Or51r1 UTSW 7 102,220,971 (GRCm39) start gained probably benign
R9074:Or51r1 UTSW 7 102,228,433 (GRCm39) missense probably damaging 0.99
R9101:Or51r1 UTSW 7 102,228,137 (GRCm39) missense probably benign 0.22
R9151:Or51r1 UTSW 7 102,228,500 (GRCm39) missense probably damaging 1.00
R9745:Or51r1 UTSW 7 102,227,861 (GRCm39) missense probably damaging 0.98
X0067:Or51r1 UTSW 7 102,227,707 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGTTCTGCAATACCAGCACTC -3'
(R):5'- GCATAATGCAGAGGATCCCG -3'

Sequencing Primer
(F):5'- AGCACTCCTGGTCACTCCAC -3'
(R):5'- TCCCGGATGGCAATGAAGC -3'
Posted On 2021-04-30