Mutagenetix > Incidental Mutation

Incidental Mutation 'R8701:Muc2'

669072

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R8701 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141695607 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 536 (D536G)

Ref Sequence

ENSEMBL: ENSMUSP00000141040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000167366

SMART Domains

Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	72	2.3e-14	PFAM
C8	107	181	1.82e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179227

SMART Domains

Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
C8	11	85	1.61e-32	SMART
Blast:VWD	102	128	5e-8	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000185406
AA Change: D536G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515
AA Change: D536G

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
VWD	20	183	1.5e-40	SMART
C8	216	290	3.9e-15	SMART
Pfam:TIL	293	349	5.4e-10	PFAM
VWC	351	411	7e-4	SMART
VWD	378	542	8.8e-44	SMART
C8	579	653	1.2e-36	SMART
SCOP:d1coua_	654	728	4e-8	SMART
VWC_def	820	865	1.3e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185823

SMART Domains

Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	73	5.6e-14	PFAM
C8	108	182	1.4e-35	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	A	T	1: 26,685,445	V218D	probably benign	Het
Abcc4	T	C	14: 118,599,373	I659V	probably benign	Het
Adamtsl4	T	A	3: 95,684,966	D24V	possibly damaging	Het
Agtr1b	A	T	3: 20,316,092	F117I	probably damaging	Het
Aldh3b2	A	G	19: 3,978,448	E116G	probably damaging	Het
Alox5	T	A	6: 116,413,826	I455F	possibly damaging	Het
Arnt	C	T	3: 95,493,765	S675F	possibly damaging	Het
C330027C09Rik	T	A	16: 49,007,141	Y456*	probably null	Het
Camkv	A	G	9: 107,948,041	T414A	possibly damaging	Het
Cd209c	C	T	8: 3,945,892	R6H	probably benign	Het
Cnr1	A	G	4: 33,944,739	I376V	probably benign	Het
Cyp2j12	T	A	4: 96,121,573	K183M	possibly damaging	Het
Dact3	G	T	7: 16,885,276	R232L	probably damaging	Het
Dlg5	G	A	14: 24,176,700	T378M	probably benign	Het
Dnah10	T	A	5: 124,726,847	D79E	probably benign	Het
Dsc1	A	T	18: 20,107,682	Y195*	probably null	Het
Elovl1	A	T	4: 118,430,510	M1L	probably benign	Het
Fam107a	A	G	14: 8,298,755	F124L	probably damaging	Het
Fam219a	A	G	4: 41,520,283	M155T	probably damaging	Het
Gm28308	C	G	6: 52,163,450		probably benign	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gtf2ird2	T	A	5: 134,216,235	I445N	probably damaging	Het
Gzmb	A	T	14: 56,260,360	V141E	probably benign	Het
Hmcn1	A	T	1: 150,755,257	M930K	probably benign	Het
Hunk	T	A	16: 90,386,610	F52Y	probably damaging	Het
Il18rap	A	G	1: 40,539,341	E304G	probably benign	Het
Klk14	A	G	7: 43,694,142	S133G	possibly damaging	Het
Man2b1	T	C	8: 85,095,153	S695P	probably damaging	Het
Mccc1	A	T	3: 35,995,784	D86E	probably benign	Het
Mcu	T	A	10: 59,467,653	I121F	probably damaging	Het
Mlxipl	T	C	5: 135,107,191	F90S	possibly damaging	Het
Naa11	T	C	5: 97,391,958	S114G	possibly damaging	Het
Ncaph	T	C	2: 127,106,138	K676E	probably benign	Het
Neurl2	C	T	2: 164,833,134	D103N	probably benign	Het
Nup210l	T	C	3: 90,122,814	M278T	probably benign	Het
Olfr1192-ps1	A	G	2: 88,652,487	I112V	possibly damaging	Het
Olfr550	A	T	7: 102,578,692	M66L	possibly damaging	Het
Olfr897-ps1	A	T	9: 38,309,438	L214F	unknown	Het
Olfr967	A	T	9: 39,750,914	H176L	probably damaging	Het
Olfr981	A	G	9: 40,022,519	N42S	probably damaging	Het
Pcdh20	A	T	14: 88,468,413	Y484N	possibly damaging	Het
Pkhd1l1	A	G	15: 44,574,683	Y3598C	probably damaging	Het
Plcg2	T	A	8: 117,581,677	L336Q	probably damaging	Het
Ppp1r8	T	C	4: 132,830,642	D207G	possibly damaging	Het
Prdm13	C	T	4: 21,678,615	C625Y	probably damaging	Het
Ptcd3	T	C	6: 71,885,511	D480G	possibly damaging	Het
Rbm39	T	A	2: 156,161,587	K291M	probably damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rnf220	T	C	4: 117,489,993	H74R	probably damaging	Het
Sp6	A	T	11: 97,022,264	T268S	probably damaging	Het
Sphk2	A	T	7: 45,710,825	V585E	probably damaging	Het
Syne1	G	A	10: 5,205,026	Q5638*	probably null	Het
Tas1r3	C	T	4: 155,861,046	V573I	probably benign	Het
Tdrd1	T	C	19: 56,851,484	S659P	possibly damaging	Het
Tead4	T	A	6: 128,242,566	K237N	probably damaging	Het
Tex24	T	A	8: 27,345,124	C227S	probably benign	Het
Tom1	A	T	8: 75,052,168	T174S	probably benign	Het
Tpm3	C	T	3: 90,087,680	R168C	possibly damaging	Het
Trpv3	A	G	11: 73,278,936	E111G	possibly damaging	Het
Unc80	A	G	1: 66,638,032	D2040G	possibly damaging	Het
Usp47	A	G	7: 112,093,195	T955A	probably damaging	Het
Vmn2r11	G	A	5: 109,047,690	A590V	probably damaging	Het
Wisp2	G	T	2: 163,828,866	G98W	probably damaging	Het
Zfp112	A	G	7: 24,125,740	R382G	probably damaging	Het
Zfp606	T	A	7: 12,481,098	D84E	unknown	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- CAGTTGCTTCCAGTCATGCAG -3'
(R):5'- AGGCTGGACTGTCAGGATTG -3'

Sequencing Primer
(F):5'- CAGCTTTTTGTGACTCTGGACCAG -3'
(R):5'- GTGTGTCCTTGACAAGCCAG -3'

Posted On

2021-04-30