Mutagenetix > Incidental Mutation

Incidental Mutation 'R8701:Muc2'

669072

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

068555-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R8701 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141276583-141308428 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141281850 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 536 (D536G)

Ref Sequence

ENSEMBL: ENSMUSP00000141040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000167366

SMART Domains

Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	72	2.3e-14	PFAM
C8	107	181	1.82e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179227

SMART Domains

Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
C8	11	85	1.61e-32	SMART
Blast:VWD	102	128	5e-8	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000185406
AA Change: D536G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515
AA Change: D536G

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
VWD	20	183	1.5e-40	SMART
C8	216	290	3.9e-15	SMART
Pfam:TIL	293	349	5.4e-10	PFAM
VWC	351	411	7e-4	SMART
VWD	378	542	8.8e-44	SMART
C8	579	653	1.2e-36	SMART
SCOP:d1coua_	654	728	4e-8	SMART
VWC_def	820	865	1.3e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185823

SMART Domains

Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	73	5.6e-14	PFAM
C8	108	182	1.4e-35	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	T	C	14: 118,836,785 (GRCm39)	I659V	probably benign	Het
Adamtsl4	T	A	3: 95,592,276 (GRCm39)	D24V	possibly damaging	Het
Agtr1b	A	T	3: 20,370,256 (GRCm39)	F117I	probably damaging	Het
Aldh3b2	A	G	19: 4,028,448 (GRCm39)	E116G	probably damaging	Het
Alox5	T	A	6: 116,390,787 (GRCm39)	I455F	possibly damaging	Het
Arnt	C	T	3: 95,401,076 (GRCm39)	S675F	possibly damaging	Het
Camkv	A	G	9: 107,825,240 (GRCm39)	T414A	possibly damaging	Het
Ccn5	G	T	2: 163,670,786 (GRCm39)	G98W	probably damaging	Het
Cd209c	C	T	8: 3,995,892 (GRCm39)	R6H	probably benign	Het
Cip2a	T	A	16: 48,827,504 (GRCm39)	Y456*	probably null	Het
Cnr1	A	G	4: 33,944,739 (GRCm39)	I376V	probably benign	Het
Cyp2j12	T	A	4: 96,009,810 (GRCm39)	K183M	possibly damaging	Het
Dact3	G	T	7: 16,619,201 (GRCm39)	R232L	probably damaging	Het
Dlg5	G	A	14: 24,226,768 (GRCm39)	T378M	probably benign	Het
Dnah10	T	A	5: 124,803,911 (GRCm39)	D79E	probably benign	Het
Dsc1	A	T	18: 20,240,739 (GRCm39)	Y195*	probably null	Het
Elovl1	A	T	4: 118,287,707 (GRCm39)	M1L	probably benign	Het
Fam107a	A	G	14: 8,298,755 (GRCm38)	F124L	probably damaging	Het
Fam219a	A	G	4: 41,520,283 (GRCm39)	M155T	probably damaging	Het
Gm28308	C	G	6: 52,140,430 (GRCm39)		probably benign	Het
Gpr153	C	T	4: 152,363,558 (GRCm39)		probably benign	Het
Gtf2ird2	T	A	5: 134,245,077 (GRCm39)	I445N	probably damaging	Het
Gzmb	A	T	14: 56,497,817 (GRCm39)	V141E	probably benign	Het
Hmcn1	A	T	1: 150,631,008 (GRCm39)	M930K	probably benign	Het
Hunk	T	A	16: 90,183,498 (GRCm39)	F52Y	probably damaging	Het
Il18rap	A	G	1: 40,578,501 (GRCm39)	E304G	probably benign	Het
Klk14	A	G	7: 43,343,566 (GRCm39)	S133G	possibly damaging	Het
Man2b1	T	C	8: 85,821,782 (GRCm39)	S695P	probably damaging	Het
Mccc1	A	T	3: 36,049,933 (GRCm39)	D86E	probably benign	Het
Mcu	T	A	10: 59,303,475 (GRCm39)	I121F	probably damaging	Het
Mlxipl	T	C	5: 135,136,045 (GRCm39)	F90S	possibly damaging	Het
Naa11	T	C	5: 97,539,817 (GRCm39)	S114G	possibly damaging	Het
Ncaph	T	C	2: 126,948,058 (GRCm39)	K676E	probably benign	Het
Neurl2	C	T	2: 164,675,054 (GRCm39)	D103N	probably benign	Het
Nup210l	T	C	3: 90,030,121 (GRCm39)	M278T	probably benign	Het
Or10g6	A	G	9: 39,933,815 (GRCm39)	N42S	probably damaging	Het
Or4p4	A	G	2: 88,482,831 (GRCm39)	I112V	possibly damaging	Het
Or51r1	A	T	7: 102,227,899 (GRCm39)	M66L	possibly damaging	Het
Or8c19-ps1	A	T	9: 38,220,734 (GRCm39)	L214F	unknown	Het
Or8g4	A	T	9: 39,662,210 (GRCm39)	H176L	probably damaging	Het
Pcdh20	A	T	14: 88,705,849 (GRCm39)	Y484N	possibly damaging	Het
Pkhd1l1	A	G	15: 44,438,079 (GRCm39)	Y3598C	probably damaging	Het
Plcg2	T	A	8: 118,308,416 (GRCm39)	L336Q	probably damaging	Het
Ppp1r8	T	C	4: 132,557,953 (GRCm39)	D207G	possibly damaging	Het
Prdm13	C	T	4: 21,678,615 (GRCm39)	C625Y	probably damaging	Het
Ptcd3	T	C	6: 71,862,495 (GRCm39)	D480G	possibly damaging	Het
Rbm39	T	A	2: 156,003,507 (GRCm39)	K291M	probably damaging	Het
Repin1	G	T	6: 48,574,279 (GRCm39)	E403*	probably null	Het
Rnf220	T	C	4: 117,347,190 (GRCm39)	H74R	probably damaging	Het
Sp6	A	T	11: 96,913,090 (GRCm39)	T268S	probably damaging	Het
Spata31e2	A	T	1: 26,724,526 (GRCm39)	V218D	probably benign	Het
Sphk2	A	T	7: 45,360,249 (GRCm39)	V585E	probably damaging	Het
Syne1	G	A	10: 5,155,026 (GRCm39)	Q5638*	probably null	Het
Tas1r3	C	T	4: 155,945,503 (GRCm39)	V573I	probably benign	Het
Tdrd1	T	C	19: 56,839,916 (GRCm39)	S659P	possibly damaging	Het
Tead4	T	A	6: 128,219,529 (GRCm39)	K237N	probably damaging	Het
Tex24	T	A	8: 27,835,152 (GRCm39)	C227S	probably benign	Het
Tom1	A	T	8: 75,778,796 (GRCm39)	T174S	probably benign	Het
Tpm3	C	T	3: 89,994,987 (GRCm39)	R168C	possibly damaging	Het
Trpv3	A	G	11: 73,169,762 (GRCm39)	E111G	possibly damaging	Het
Unc80	A	G	1: 66,677,191 (GRCm39)	D2040G	possibly damaging	Het
Usp47	A	G	7: 111,692,402 (GRCm39)	T955A	probably damaging	Het
Vmn2r11	G	A	5: 109,195,556 (GRCm39)	A590V	probably damaging	Het
Zfp112	A	G	7: 23,825,165 (GRCm39)	R382G	probably damaging	Het
Zfp606	T	A	7: 12,215,025 (GRCm39)	D84E	unknown	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141,693,356 (GRCm38)	missense	probably benign	0.35
kenny	APN	7	0 ()	nonsense
Winnie	APN	7	141,286,029 (GRCm39)	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141,306,132 (GRCm39)	missense	probably benign
IGL01482:Muc2	APN	7	141,307,797 (GRCm39)	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141,306,477 (GRCm39)	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141,305,241 (GRCm39)	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141,305,609 (GRCm39)	nonsense	probably null
IGL02548:Muc2	APN	7	141,305,594 (GRCm39)	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141,300,450 (GRCm39)	unclassified	probably benign
IGL03196:Muc2	APN	7	141,301,367 (GRCm39)	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141,307,176 (GRCm39)	missense	unknown
nomoco	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
Schlendrian	UTSW	7	141,281,925 (GRCm39)	missense	probably damaging	1.00
Seco	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141,282,598 (GRCm39)	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141,302,691 (GRCm39)	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141,302,708 (GRCm39)	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0299:Muc2	UTSW	7	141,306,466 (GRCm39)	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0699:Muc2	UTSW	7	141,306,037 (GRCm39)	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1348:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141,283,405 (GRCm39)	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141,287,444 (GRCm39)	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R2163:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R3008:Muc2	UTSW	7	141,281,347 (GRCm39)	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3112:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3424:Muc2	UTSW	7	141,279,595 (GRCm39)	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141,283,590 (GRCm39)	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141,308,081 (GRCm39)	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3974:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3976:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R4327:Muc2	UTSW	7	141,281,577 (GRCm39)	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141,306,082 (GRCm39)	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141,299,345 (GRCm39)	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141,286,260 (GRCm39)	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141,307,877 (GRCm39)	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141,303,280 (GRCm39)	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141,305,169 (GRCm39)	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141,277,446 (GRCm39)	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141,299,381 (GRCm39)	unclassified	probably benign
R5919:Muc2	UTSW	7	141,281,171 (GRCm39)	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141,287,951 (GRCm39)	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141,305,143 (GRCm39)	missense	probably damaging	0.99
R5979:Muc2	UTSW	7	141,283,493 (GRCm39)	splice site	probably null
R6175:Muc2	UTSW	7	141,282,875 (GRCm39)	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141,305,151 (GRCm39)	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141,306,140 (GRCm39)	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141,287,397 (GRCm39)	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141,305,883 (GRCm39)	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141,300,473 (GRCm39)	unclassified	probably benign
R6582:Muc2	UTSW	7	141,282,941 (GRCm39)	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141,305,214 (GRCm39)	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141,306,432 (GRCm39)	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141,284,077 (GRCm39)	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141,305,194 (GRCm39)	missense	unknown
R7222:Muc2	UTSW	7	141,290,758 (GRCm39)	missense
R7251:Muc2	UTSW	7	141,278,965 (GRCm39)	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141,306,481 (GRCm39)	missense
R7315:Muc2	UTSW	7	141,276,645 (GRCm39)	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141,301,863 (GRCm39)	missense
R7556:Muc2	UTSW	7	141,307,439 (GRCm39)	missense
R7651:Muc2	UTSW	7	141,290,750 (GRCm39)	missense
R7710:Muc2	UTSW	7	141,287,452 (GRCm39)	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141,290,942 (GRCm39)	missense
R7813:Muc2	UTSW	7	141,282,543 (GRCm39)	splice site	probably null
R7843:Muc2	UTSW	7	141,281,662 (GRCm39)	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141,303,471 (GRCm39)	missense
R7924:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141,308,173 (GRCm39)	missense
R8053:Muc2	UTSW	7	141,284,575 (GRCm39)	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141,298,422 (GRCm39)	missense
R8099:Muc2	UTSW	7	141,299,175 (GRCm39)	splice site	probably null
R8192:Muc2	UTSW	7	141,305,215 (GRCm39)	missense
R8194:Muc2	UTSW	7	141,290,801 (GRCm39)	missense
R8545:Muc2	UTSW	7	141,306,130 (GRCm39)	missense	unknown
R8883:Muc2	UTSW	7	141,287,469 (GRCm39)	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141,280,758 (GRCm39)	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141,279,643 (GRCm39)	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141,287,936 (GRCm39)	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9104:Muc2	UTSW	7	141,286,224 (GRCm39)	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141,287,983 (GRCm39)	nonsense	probably null
R9270:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9297:Muc2	UTSW	7	141,302,759 (GRCm39)	missense
R9325:Muc2	UTSW	7	141,298,559 (GRCm39)	missense
R9354:Muc2	UTSW	7	141,307,157 (GRCm39)	missense
R9386:Muc2	UTSW	7	141,279,389 (GRCm39)	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141,287,453 (GRCm39)	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141,308,242 (GRCm39)	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141,300,559 (GRCm39)	missense
R9607:Muc2	UTSW	7	141,305,190 (GRCm39)	missense
R9646:Muc2	UTSW	7	141,276,643 (GRCm39)	missense	probably benign
R9651:Muc2	UTSW	7	141,288,014 (GRCm39)	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141,285,811 (GRCm39)	missense	probably benign
R9784:Muc2	UTSW	7	141,280,785 (GRCm39)	nonsense	probably null
Z1176:Muc2	UTSW	7	141,300,451 (GRCm39)	missense
Z1177:Muc2	UTSW	7	141,298,531 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- CAGTTGCTTCCAGTCATGCAG -3'
(R):5'- AGGCTGGACTGTCAGGATTG -3'

Sequencing Primer
(F):5'- CAGCTTTTTGTGACTCTGGACCAG -3'
(R):5'- GTGTGTCCTTGACAAGCCAG -3'

Posted On

2021-04-30