Incidental Mutation 'R8701:Cd209c'
ID669073
Institutional Source Beutler Lab
Gene Symbol Cd209c
Ensembl Gene ENSMUSG00000040165
Gene NameCD209c antigen
SynonymsSIGNR2, mSIGNR2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R8701 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location3940222-3954746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3945892 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 6 (R6H)
Ref Sequence ENSEMBL: ENSMUSP00000039861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044060] [ENSMUST00000208622]
Predicted Effect probably benign
Transcript: ENSMUST00000044060
AA Change: R6H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039861
Gene: ENSMUSG00000040165
AA Change: R6H

DomainStartEndE-ValueType
CLECT 48 169 7.66e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127592
SMART Domains Protein: ENSMUSP00000120433
Gene: ENSMUSG00000040165

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153915
Predicted Effect probably benign
Transcript: ENSMUST00000208622
AA Change: R6H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208902
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,445 V218D probably benign Het
Abcc4 T C 14: 118,599,373 I659V probably benign Het
Adamtsl4 T A 3: 95,684,966 D24V possibly damaging Het
Agtr1b A T 3: 20,316,092 F117I probably damaging Het
Aldh3b2 A G 19: 3,978,448 E116G probably damaging Het
Alox5 T A 6: 116,413,826 I455F possibly damaging Het
Arnt C T 3: 95,493,765 S675F possibly damaging Het
C330027C09Rik T A 16: 49,007,141 Y456* probably null Het
Camkv A G 9: 107,948,041 T414A possibly damaging Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2j12 T A 4: 96,121,573 K183M possibly damaging Het
Dact3 G T 7: 16,885,276 R232L probably damaging Het
Dlg5 G A 14: 24,176,700 T378M probably benign Het
Dnah10 T A 5: 124,726,847 D79E probably benign Het
Dsc1 A T 18: 20,107,682 Y195* probably null Het
Elovl1 A T 4: 118,430,510 M1L probably benign Het
Fam107a A G 14: 8,298,755 F124L probably damaging Het
Fam219a A G 4: 41,520,283 M155T probably damaging Het
Gm28308 C G 6: 52,163,450 probably benign Het
Gpr153 C T 4: 152,279,101 probably benign Het
Gtf2ird2 T A 5: 134,216,235 I445N probably damaging Het
Gzmb A T 14: 56,260,360 V141E probably benign Het
Hmcn1 A T 1: 150,755,257 M930K probably benign Het
Hunk T A 16: 90,386,610 F52Y probably damaging Het
Il18rap A G 1: 40,539,341 E304G probably benign Het
Klk14 A G 7: 43,694,142 S133G possibly damaging Het
Man2b1 T C 8: 85,095,153 S695P probably damaging Het
Mccc1 A T 3: 35,995,784 D86E probably benign Het
Mcu T A 10: 59,467,653 I121F probably damaging Het
Mlxipl T C 5: 135,107,191 F90S possibly damaging Het
Muc2 A G 7: 141,695,607 D536G probably damaging Het
Naa11 T C 5: 97,391,958 S114G possibly damaging Het
Ncaph T C 2: 127,106,138 K676E probably benign Het
Neurl2 C T 2: 164,833,134 D103N probably benign Het
Nup210l T C 3: 90,122,814 M278T probably benign Het
Olfr1192-ps1 A G 2: 88,652,487 I112V possibly damaging Het
Olfr550 A T 7: 102,578,692 M66L possibly damaging Het
Olfr897-ps1 A T 9: 38,309,438 L214F unknown Het
Olfr967 A T 9: 39,750,914 H176L probably damaging Het
Olfr981 A G 9: 40,022,519 N42S probably damaging Het
Pcdh20 A T 14: 88,468,413 Y484N possibly damaging Het
Pkhd1l1 A G 15: 44,574,683 Y3598C probably damaging Het
Plcg2 T A 8: 117,581,677 L336Q probably damaging Het
Ppp1r8 T C 4: 132,830,642 D207G possibly damaging Het
Prdm13 C T 4: 21,678,615 C625Y probably damaging Het
Ptcd3 T C 6: 71,885,511 D480G possibly damaging Het
Rbm39 T A 2: 156,161,587 K291M probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rnf220 T C 4: 117,489,993 H74R probably damaging Het
Sp6 A T 11: 97,022,264 T268S probably damaging Het
Sphk2 A T 7: 45,710,825 V585E probably damaging Het
Syne1 G A 10: 5,205,026 Q5638* probably null Het
Tas1r3 C T 4: 155,861,046 V573I probably benign Het
Tdrd1 T C 19: 56,851,484 S659P possibly damaging Het
Tead4 T A 6: 128,242,566 K237N probably damaging Het
Tex24 T A 8: 27,345,124 C227S probably benign Het
Tom1 A T 8: 75,052,168 T174S probably benign Het
Tpm3 C T 3: 90,087,680 R168C possibly damaging Het
Trpv3 A G 11: 73,278,936 E111G possibly damaging Het
Unc80 A G 1: 66,638,032 D2040G possibly damaging Het
Usp47 A G 7: 112,093,195 T955A probably damaging Het
Vmn2r11 G A 5: 109,047,690 A590V probably damaging Het
Wisp2 G T 2: 163,828,866 G98W probably damaging Het
Zfp112 A G 7: 24,125,740 R382G probably damaging Het
Zfp606 T A 7: 12,481,098 D84E unknown Het
Other mutations in Cd209c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Cd209c APN 8 3940339 missense probably damaging 1.00
IGL01340:Cd209c APN 8 3945892 missense probably benign 0.00
IGL02682:Cd209c APN 8 3940324 missense probably damaging 0.99
R1311:Cd209c UTSW 8 3945908 start codon destroyed probably benign
R1859:Cd209c UTSW 8 3944953 missense probably benign
R4374:Cd209c UTSW 8 3954635 exon noncoding transcript
R4375:Cd209c UTSW 8 3954635 exon noncoding transcript
R4377:Cd209c UTSW 8 3954635 exon noncoding transcript
R4769:Cd209c UTSW 8 3944953 missense probably benign
R4786:Cd209c UTSW 8 3945698 missense possibly damaging 0.77
R4841:Cd209c UTSW 8 3945905 missense probably benign 0.00
R4842:Cd209c UTSW 8 3945905 missense probably benign 0.00
R4869:Cd209c UTSW 8 3944077 missense probably benign 0.00
R5333:Cd209c UTSW 8 3944976 missense probably damaging 1.00
R5835:Cd209c UTSW 8 3945699 missense probably benign 0.01
R6369:Cd209c UTSW 8 3944984 missense probably damaging 1.00
R6497:Cd209c UTSW 8 3944122 missense possibly damaging 0.72
R6591:Cd209c UTSW 8 3945680 missense probably benign 0.14
R6691:Cd209c UTSW 8 3945680 missense probably benign 0.14
R7181:Cd209c UTSW 8 3945712 missense probably benign 0.01
R8067:Cd209c UTSW 8 3945700 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCAGCTGGGTCATCTCCTTG -3'
(R):5'- TCCTAGGCCTATAAAAGCAGC -3'

Sequencing Primer
(F):5'- AGCTGGGTCATCTCCTTGTATAC -3'
(R):5'- CAGCTCTGGGCAAAAAGTCTTTTC -3'
Posted On2021-04-30