Incidental Mutation 'R8701:Sp6'
ID 669085
Institutional Source Beutler Lab
Gene Symbol Sp6
Ensembl Gene ENSMUSG00000038560
Gene Name trans-acting transcription factor 6
Synonyms Epfn, Klf14, epiprofin, 1110025J03Rik
MMRRC Submission 068555-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R8701 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 96904395-96915565 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 96913090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 268 (T268S)
Ref Sequence ENSEMBL: ENSMUSP00000039307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047997] [ENSMUST00000107622]
AlphaFold Q9ESX2
Predicted Effect probably damaging
Transcript: ENSMUST00000047997
AA Change: T268S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039307
Gene: ENSMUSG00000038560
AA Change: T268S

DomainStartEndE-ValueType
low complexity region 163 177 N/A INTRINSIC
ZnF_C2H2 254 278 3.99e0 SMART
ZnF_C2H2 284 308 2.99e-4 SMART
ZnF_C2H2 314 336 3.16e-3 SMART
low complexity region 337 364 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107622
AA Change: T268S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103248
Gene: ENSMUSG00000038560
AA Change: T268S

DomainStartEndE-ValueType
low complexity region 163 177 N/A INTRINSIC
ZnF_C2H2 254 278 3.99e0 SMART
ZnF_C2H2 284 308 2.99e-4 SMART
ZnF_C2H2 314 336 3.16e-3 SMART
low complexity region 337 364 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SP6 belongs to a family of transcription factors that contain 3 classical zinc finger DNA-binding domains consisting of a zinc atom tetrahedrally coordinated by 2 cysteines and 2 histidines (C2H2 motif). These transcription factors bind to GC-rich sequences and related GT and CACCC boxes (Scohy et al., 2000 [PubMed 11087666]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a disruption at this locus display impaired skin, hair follicle, tooth and lung development as well as limb abnormalities and partial postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,836,785 (GRCm39) I659V probably benign Het
Adamtsl4 T A 3: 95,592,276 (GRCm39) D24V possibly damaging Het
Agtr1b A T 3: 20,370,256 (GRCm39) F117I probably damaging Het
Aldh3b2 A G 19: 4,028,448 (GRCm39) E116G probably damaging Het
Alox5 T A 6: 116,390,787 (GRCm39) I455F possibly damaging Het
Arnt C T 3: 95,401,076 (GRCm39) S675F possibly damaging Het
Camkv A G 9: 107,825,240 (GRCm39) T414A possibly damaging Het
Ccn5 G T 2: 163,670,786 (GRCm39) G98W probably damaging Het
Cd209c C T 8: 3,995,892 (GRCm39) R6H probably benign Het
Cip2a T A 16: 48,827,504 (GRCm39) Y456* probably null Het
Cnr1 A G 4: 33,944,739 (GRCm39) I376V probably benign Het
Cyp2j12 T A 4: 96,009,810 (GRCm39) K183M possibly damaging Het
Dact3 G T 7: 16,619,201 (GRCm39) R232L probably damaging Het
Dlg5 G A 14: 24,226,768 (GRCm39) T378M probably benign Het
Dnah10 T A 5: 124,803,911 (GRCm39) D79E probably benign Het
Dsc1 A T 18: 20,240,739 (GRCm39) Y195* probably null Het
Elovl1 A T 4: 118,287,707 (GRCm39) M1L probably benign Het
Fam107a A G 14: 8,298,755 (GRCm38) F124L probably damaging Het
Fam219a A G 4: 41,520,283 (GRCm39) M155T probably damaging Het
Gm28308 C G 6: 52,140,430 (GRCm39) probably benign Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gtf2ird2 T A 5: 134,245,077 (GRCm39) I445N probably damaging Het
Gzmb A T 14: 56,497,817 (GRCm39) V141E probably benign Het
Hmcn1 A T 1: 150,631,008 (GRCm39) M930K probably benign Het
Hunk T A 16: 90,183,498 (GRCm39) F52Y probably damaging Het
Il18rap A G 1: 40,578,501 (GRCm39) E304G probably benign Het
Klk14 A G 7: 43,343,566 (GRCm39) S133G possibly damaging Het
Man2b1 T C 8: 85,821,782 (GRCm39) S695P probably damaging Het
Mccc1 A T 3: 36,049,933 (GRCm39) D86E probably benign Het
Mcu T A 10: 59,303,475 (GRCm39) I121F probably damaging Het
Mlxipl T C 5: 135,136,045 (GRCm39) F90S possibly damaging Het
Muc2 A G 7: 141,281,850 (GRCm39) D536G probably damaging Het
Naa11 T C 5: 97,539,817 (GRCm39) S114G possibly damaging Het
Ncaph T C 2: 126,948,058 (GRCm39) K676E probably benign Het
Neurl2 C T 2: 164,675,054 (GRCm39) D103N probably benign Het
Nup210l T C 3: 90,030,121 (GRCm39) M278T probably benign Het
Or10g6 A G 9: 39,933,815 (GRCm39) N42S probably damaging Het
Or4p4 A G 2: 88,482,831 (GRCm39) I112V possibly damaging Het
Or51r1 A T 7: 102,227,899 (GRCm39) M66L possibly damaging Het
Or8c19-ps1 A T 9: 38,220,734 (GRCm39) L214F unknown Het
Or8g4 A T 9: 39,662,210 (GRCm39) H176L probably damaging Het
Pcdh20 A T 14: 88,705,849 (GRCm39) Y484N possibly damaging Het
Pkhd1l1 A G 15: 44,438,079 (GRCm39) Y3598C probably damaging Het
Plcg2 T A 8: 118,308,416 (GRCm39) L336Q probably damaging Het
Ppp1r8 T C 4: 132,557,953 (GRCm39) D207G possibly damaging Het
Prdm13 C T 4: 21,678,615 (GRCm39) C625Y probably damaging Het
Ptcd3 T C 6: 71,862,495 (GRCm39) D480G possibly damaging Het
Rbm39 T A 2: 156,003,507 (GRCm39) K291M probably damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rnf220 T C 4: 117,347,190 (GRCm39) H74R probably damaging Het
Spata31e2 A T 1: 26,724,526 (GRCm39) V218D probably benign Het
Sphk2 A T 7: 45,360,249 (GRCm39) V585E probably damaging Het
Syne1 G A 10: 5,155,026 (GRCm39) Q5638* probably null Het
Tas1r3 C T 4: 155,945,503 (GRCm39) V573I probably benign Het
Tdrd1 T C 19: 56,839,916 (GRCm39) S659P possibly damaging Het
Tead4 T A 6: 128,219,529 (GRCm39) K237N probably damaging Het
Tex24 T A 8: 27,835,152 (GRCm39) C227S probably benign Het
Tom1 A T 8: 75,778,796 (GRCm39) T174S probably benign Het
Tpm3 C T 3: 89,994,987 (GRCm39) R168C possibly damaging Het
Trpv3 A G 11: 73,169,762 (GRCm39) E111G possibly damaging Het
Unc80 A G 1: 66,677,191 (GRCm39) D2040G possibly damaging Het
Usp47 A G 7: 111,692,402 (GRCm39) T955A probably damaging Het
Vmn2r11 G A 5: 109,195,556 (GRCm39) A590V probably damaging Het
Zfp112 A G 7: 23,825,165 (GRCm39) R382G probably damaging Het
Zfp606 T A 7: 12,215,025 (GRCm39) D84E unknown Het
Other mutations in Sp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sp6 APN 11 96,913,429 (GRCm39) utr 3 prime probably benign
R0281:Sp6 UTSW 11 96,912,751 (GRCm39) missense probably benign 0.24
R0326:Sp6 UTSW 11 96,912,361 (GRCm39) missense possibly damaging 0.90
R0584:Sp6 UTSW 11 96,913,091 (GRCm39) missense probably damaging 1.00
R0678:Sp6 UTSW 11 96,912,607 (GRCm39) missense probably damaging 0.99
R0690:Sp6 UTSW 11 96,912,370 (GRCm39) missense possibly damaging 0.89
R1909:Sp6 UTSW 11 96,912,334 (GRCm39) missense probably benign 0.04
R1950:Sp6 UTSW 11 96,912,940 (GRCm39) missense probably benign 0.14
R3697:Sp6 UTSW 11 96,912,580 (GRCm39) missense possibly damaging 0.86
R4380:Sp6 UTSW 11 96,912,572 (GRCm39) missense probably damaging 0.98
R4666:Sp6 UTSW 11 96,912,701 (GRCm39) missense probably benign 0.19
X0011:Sp6 UTSW 11 96,913,351 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TATGAATCGTGGTTCCGGCC -3'
(R):5'- ATGAAGACTCGGCTGCAGAC -3'

Sequencing Primer
(F):5'- TCGGAGACCATCAGCTCTGTG -3'
(R):5'- ACCGCACAGGGGAACTTCTTG -3'
Posted On 2021-04-30