Incidental Mutation 'R8701:Dlg5'
ID 669087
Institutional Source Beutler Lab
Gene Symbol Dlg5
Ensembl Gene ENSMUSG00000021782
Gene Name discs large MAGUK scaffold protein 5
Synonyms 4933429D20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001163513; MGI: 1918478

Essential gene? Essential (E-score: 1.000) question?
Stock # R8701 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 24133953-24245920 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24176700 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 378 (T378M)
Ref Sequence ENSEMBL: ENSMUSP00000087879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042009] [ENSMUST00000073687] [ENSMUST00000090398]
AlphaFold E9Q9R9
Predicted Effect probably benign
Transcript: ENSMUST00000042009
AA Change: T24M

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000044852
Gene: ENSMUSG00000021782
AA Change: T24M

DomainStartEndE-ValueType
coiled coil region 20 247 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
PDZ 279 356 2.02e-10 SMART
PDZ 364 447 9.5e-16 SMART
low complexity region 510 517 N/A INTRINSIC
low complexity region 692 711 N/A INTRINSIC
low complexity region 903 918 N/A INTRINSIC
PDZ 1009 1080 2.1e-17 SMART
PDZ 1164 1236 2.97e-8 SMART
SH3 1250 1314 3.73e-7 SMART
low complexity region 1338 1358 N/A INTRINSIC
GuKc 1375 1561 5.43e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073687
AA Change: T355M

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000073367
Gene: ENSMUSG00000021782
AA Change: T355M

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
Pfam:Takusan 104 191 1.4e-27 PFAM
coiled coil region 308 578 N/A INTRINSIC
low complexity region 592 605 N/A INTRINSIC
PDZ 610 687 2.02e-10 SMART
PDZ 695 773 1.25e-15 SMART
low complexity region 836 843 N/A INTRINSIC
low complexity region 1018 1037 N/A INTRINSIC
low complexity region 1229 1244 N/A INTRINSIC
PDZ 1335 1406 2.1e-17 SMART
PDZ 1490 1562 2.97e-8 SMART
SH3 1576 1640 3.73e-7 SMART
low complexity region 1664 1684 N/A INTRINSIC
GuKc 1701 1887 5.43e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090398
AA Change: T378M

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000087879
Gene: ENSMUSG00000021782
AA Change: T378M

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
low complexity region 109 123 N/A INTRINSIC
Pfam:Takusan 128 213 6e-33 PFAM
coiled coil region 331 601 N/A INTRINSIC
low complexity region 615 628 N/A INTRINSIC
PDZ 633 710 2.02e-10 SMART
PDZ 718 796 1.25e-15 SMART
low complexity region 859 866 N/A INTRINSIC
low complexity region 1041 1060 N/A INTRINSIC
low complexity region 1252 1267 N/A INTRINSIC
PDZ 1358 1429 2.1e-17 SMART
PDZ 1513 1585 2.97e-8 SMART
SH3 1599 1663 3.73e-7 SMART
low complexity region 1687 1707 N/A INTRINSIC
GuKc 1724 1910 5.43e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, hydroencephaly, abnormal brain morphology, abnormal neurogenesis, kidney cysts, ureter defects, and abnormal kidney morphology. [provided by MGI curators]
Allele List at MGI

All alleles(19) : Targeted, other(1) Gene trapped(18)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,685,445 V218D probably benign Het
Abcc4 T C 14: 118,599,373 I659V probably benign Het
Adamtsl4 T A 3: 95,684,966 D24V possibly damaging Het
Agtr1b A T 3: 20,316,092 F117I probably damaging Het
Aldh3b2 A G 19: 3,978,448 E116G probably damaging Het
Alox5 T A 6: 116,413,826 I455F possibly damaging Het
Arnt C T 3: 95,493,765 S675F possibly damaging Het
C330027C09Rik T A 16: 49,007,141 Y456* probably null Het
Camkv A G 9: 107,948,041 T414A possibly damaging Het
Cd209c C T 8: 3,945,892 R6H probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2j12 T A 4: 96,121,573 K183M possibly damaging Het
Dact3 G T 7: 16,885,276 R232L probably damaging Het
Dnah10 T A 5: 124,726,847 D79E probably benign Het
Dsc1 A T 18: 20,107,682 Y195* probably null Het
Elovl1 A T 4: 118,430,510 M1L probably benign Het
Fam107a A G 14: 8,298,755 F124L probably damaging Het
Fam219a A G 4: 41,520,283 M155T probably damaging Het
Gm28308 C G 6: 52,163,450 probably benign Het
Gpr153 C T 4: 152,279,101 probably benign Het
Gtf2ird2 T A 5: 134,216,235 I445N probably damaging Het
Gzmb A T 14: 56,260,360 V141E probably benign Het
Hmcn1 A T 1: 150,755,257 M930K probably benign Het
Hunk T A 16: 90,386,610 F52Y probably damaging Het
Il18rap A G 1: 40,539,341 E304G probably benign Het
Klk14 A G 7: 43,694,142 S133G possibly damaging Het
Man2b1 T C 8: 85,095,153 S695P probably damaging Het
Mccc1 A T 3: 35,995,784 D86E probably benign Het
Mcu T A 10: 59,467,653 I121F probably damaging Het
Mlxipl T C 5: 135,107,191 F90S possibly damaging Het
Muc2 A G 7: 141,695,607 D536G probably damaging Het
Naa11 T C 5: 97,391,958 S114G possibly damaging Het
Ncaph T C 2: 127,106,138 K676E probably benign Het
Neurl2 C T 2: 164,833,134 D103N probably benign Het
Nup210l T C 3: 90,122,814 M278T probably benign Het
Olfr1192-ps1 A G 2: 88,652,487 I112V possibly damaging Het
Olfr550 A T 7: 102,578,692 M66L possibly damaging Het
Olfr897-ps1 A T 9: 38,309,438 L214F unknown Het
Olfr967 A T 9: 39,750,914 H176L probably damaging Het
Olfr981 A G 9: 40,022,519 N42S probably damaging Het
Pcdh20 A T 14: 88,468,413 Y484N possibly damaging Het
Pkhd1l1 A G 15: 44,574,683 Y3598C probably damaging Het
Plcg2 T A 8: 117,581,677 L336Q probably damaging Het
Ppp1r8 T C 4: 132,830,642 D207G possibly damaging Het
Prdm13 C T 4: 21,678,615 C625Y probably damaging Het
Ptcd3 T C 6: 71,885,511 D480G possibly damaging Het
Rbm39 T A 2: 156,161,587 K291M probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rnf220 T C 4: 117,489,993 H74R probably damaging Het
Sp6 A T 11: 97,022,264 T268S probably damaging Het
Sphk2 A T 7: 45,710,825 V585E probably damaging Het
Syne1 G A 10: 5,205,026 Q5638* probably null Het
Tas1r3 C T 4: 155,861,046 V573I probably benign Het
Tdrd1 T C 19: 56,851,484 S659P possibly damaging Het
Tead4 T A 6: 128,242,566 K237N probably damaging Het
Tex24 T A 8: 27,345,124 C227S probably benign Het
Tom1 A T 8: 75,052,168 T174S probably benign Het
Tpm3 C T 3: 90,087,680 R168C possibly damaging Het
Trpv3 A G 11: 73,278,936 E111G possibly damaging Het
Unc80 A G 1: 66,638,032 D2040G possibly damaging Het
Usp47 A G 7: 112,093,195 T955A probably damaging Het
Vmn2r11 G A 5: 109,047,690 A590V probably damaging Het
Wisp2 G T 2: 163,828,866 G98W probably damaging Het
Zfp112 A G 7: 24,125,740 R382G probably damaging Het
Zfp606 T A 7: 12,481,098 D84E unknown Het
Other mutations in Dlg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dlg5 APN 14 24191161 missense probably damaging 0.99
IGL00164:Dlg5 APN 14 24158464 missense possibly damaging 0.89
IGL00767:Dlg5 APN 14 24165285 missense probably damaging 1.00
IGL01284:Dlg5 APN 14 24146197 missense probably damaging 1.00
IGL01328:Dlg5 APN 14 24202351 missense probably damaging 0.98
IGL01532:Dlg5 APN 14 24158592 missense probably benign
IGL01621:Dlg5 APN 14 24148221 missense probably damaging 1.00
IGL01649:Dlg5 APN 14 24138691 missense probably damaging 1.00
IGL01733:Dlg5 APN 14 24170449 missense probably damaging 1.00
IGL02048:Dlg5 APN 14 24172203 missense possibly damaging 0.87
IGL02103:Dlg5 APN 14 24144346 missense probably damaging 1.00
IGL02138:Dlg5 APN 14 24158351 missense probably benign
IGL02146:Dlg5 APN 14 24202361 missense probably damaging 0.99
IGL02392:Dlg5 APN 14 24150209 missense probably damaging 1.00
IGL02427:Dlg5 APN 14 24166207 missense probably damaging 1.00
IGL02643:Dlg5 APN 14 24191182 missense probably damaging 1.00
IGL02649:Dlg5 APN 14 24146251 missense probably damaging 0.96
IGL02933:Dlg5 APN 14 24158499 missense probably benign 0.06
IGL02965:Dlg5 APN 14 24172023 missense probably damaging 1.00
IGL02988:Dlg5 APN 14 24166255 missense probably damaging 1.00
IGL03351:Dlg5 APN 14 24170454 missense probably benign 0.03
legerdemain UTSW 14 24164547 missense probably damaging 1.00
R0123:Dlg5 UTSW 14 24147206 missense probably benign
R0131:Dlg5 UTSW 14 24138649 missense probably damaging 1.00
R0709:Dlg5 UTSW 14 24146255 missense probably damaging 1.00
R0920:Dlg5 UTSW 14 24176397 missense probably damaging 1.00
R0924:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0930:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0981:Dlg5 UTSW 14 24154631 missense probably damaging 1.00
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1438:Dlg5 UTSW 14 24154605 missense possibly damaging 0.94
R1449:Dlg5 UTSW 14 24135643 missense possibly damaging 0.82
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1543:Dlg5 UTSW 14 24144448 missense probably damaging 1.00
R1824:Dlg5 UTSW 14 24149444 missense probably benign 0.28
R1899:Dlg5 UTSW 14 24148300 missense probably damaging 1.00
R1920:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1921:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1951:Dlg5 UTSW 14 24156469 splice site probably benign
R1968:Dlg5 UTSW 14 24164119 nonsense probably null
R2049:Dlg5 UTSW 14 24154647 missense probably damaging 1.00
R2070:Dlg5 UTSW 14 24136635 missense probably damaging 1.00
R2117:Dlg5 UTSW 14 24177758 nonsense probably null
R2139:Dlg5 UTSW 14 24170544 missense probably damaging 1.00
R2153:Dlg5 UTSW 14 24137157 missense probably damaging 1.00
R2283:Dlg5 UTSW 14 24158663 missense probably benign 0.00
R2293:Dlg5 UTSW 14 24158112 missense probably benign
R2356:Dlg5 UTSW 14 24170428 critical splice donor site probably null
R2362:Dlg5 UTSW 14 24158687 missense probably benign 0.04
R2513:Dlg5 UTSW 14 24164525 missense probably damaging 1.00
R3084:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3086:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3750:Dlg5 UTSW 14 24165260 missense probably damaging 1.00
R3780:Dlg5 UTSW 14 24190310 unclassified probably benign
R3782:Dlg5 UTSW 14 24190310 unclassified probably benign
R3828:Dlg5 UTSW 14 24146158 missense probably damaging 0.99
R4079:Dlg5 UTSW 14 24148260 missense possibly damaging 0.94
R4393:Dlg5 UTSW 14 24177989 critical splice acceptor site probably null
R4615:Dlg5 UTSW 14 24158168 missense probably damaging 1.00
R4664:Dlg5 UTSW 14 24137181 missense possibly damaging 0.90
R4712:Dlg5 UTSW 14 24177983 missense possibly damaging 0.94
R4796:Dlg5 UTSW 14 24144383 missense probably damaging 1.00
R4801:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4802:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4946:Dlg5 UTSW 14 24154361 missense probably damaging 0.99
R5022:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5023:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5057:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5234:Dlg5 UTSW 14 24192862 missense probably damaging 0.98
R5561:Dlg5 UTSW 14 24177792 missense probably benign 0.03
R5567:Dlg5 UTSW 14 24192913 nonsense probably null
R5570:Dlg5 UTSW 14 24192913 nonsense probably null
R5640:Dlg5 UTSW 14 24170461 missense probably damaging 1.00
R5646:Dlg5 UTSW 14 24158699 missense probably damaging 1.00
R5711:Dlg5 UTSW 14 24150648 missense probably damaging 1.00
R5810:Dlg5 UTSW 14 24146254 missense probably damaging 0.99
R5900:Dlg5 UTSW 14 24149447 missense probably damaging 1.00
R5964:Dlg5 UTSW 14 24164089 missense probably benign
R6190:Dlg5 UTSW 14 24190438 missense probably damaging 0.99
R6240:Dlg5 UTSW 14 24149528 splice site probably null
R6276:Dlg5 UTSW 14 24164568 missense probably damaging 1.00
R6339:Dlg5 UTSW 14 24158060 missense probably damaging 1.00
R6508:Dlg5 UTSW 14 24138706 missense probably benign 0.45
R6527:Dlg5 UTSW 14 24190448 missense possibly damaging 0.73
R6593:Dlg5 UTSW 14 24150652 missense probably benign 0.01
R6687:Dlg5 UTSW 14 24190373 missense probably damaging 1.00
R6965:Dlg5 UTSW 14 24149430 missense probably damaging 1.00
R7051:Dlg5 UTSW 14 24146195 missense possibly damaging 0.93
R7075:Dlg5 UTSW 14 24177797 missense possibly damaging 0.49
R7149:Dlg5 UTSW 14 24190424 missense probably benign 0.00
R7182:Dlg5 UTSW 14 24244856 missense
R7203:Dlg5 UTSW 14 24138655 missense probably damaging 1.00
R7216:Dlg5 UTSW 14 24136638 nonsense probably null
R7359:Dlg5 UTSW 14 24164547 missense probably damaging 1.00
R7466:Dlg5 UTSW 14 24245212 missense probably damaging 1.00
R7485:Dlg5 UTSW 14 24148322 missense probably benign
R7485:Dlg5 UTSW 14 24177839 missense probably damaging 0.98
R7629:Dlg5 UTSW 14 24245212 missense probably damaging 1.00
R7666:Dlg5 UTSW 14 24157799 missense probably damaging 1.00
R7804:Dlg5 UTSW 14 24165320 missense possibly damaging 0.46
R7861:Dlg5 UTSW 14 24245212 missense probably damaging 1.00
R7862:Dlg5 UTSW 14 24245212 missense probably damaging 1.00
R7864:Dlg5 UTSW 14 24245212 missense probably damaging 1.00
R7874:Dlg5 UTSW 14 24135619 missense probably damaging 1.00
R7913:Dlg5 UTSW 14 24137124 splice site probably null
R7981:Dlg5 UTSW 14 24158145 missense probably benign
R8147:Dlg5 UTSW 14 24158327 missense probably benign 0.07
R8204:Dlg5 UTSW 14 24160252 missense probably damaging 1.00
R8206:Dlg5 UTSW 14 24160268 missense possibly damaging 0.62
R8287:Dlg5 UTSW 14 24164385 missense probably benign 0.40
R8296:Dlg5 UTSW 14 24148260 missense possibly damaging 0.94
R8317:Dlg5 UTSW 14 24191230 missense probably damaging 0.98
R8327:Dlg5 UTSW 14 24146320 missense probably damaging 0.99
R8352:Dlg5 UTSW 14 24191193 missense probably damaging 1.00
R8353:Dlg5 UTSW 14 24158145 missense probably benign
R8409:Dlg5 UTSW 14 24176478 missense probably damaging 1.00
R8452:Dlg5 UTSW 14 24191193 missense probably damaging 1.00
R8453:Dlg5 UTSW 14 24158145 missense probably benign
R8540:Dlg5 UTSW 14 24158699 missense probably damaging 1.00
R8925:Dlg5 UTSW 14 24156479 missense
R8927:Dlg5 UTSW 14 24156479 missense
R9025:Dlg5 UTSW 14 24149478 missense probably benign 0.00
R9102:Dlg5 UTSW 14 24149499 missense probably damaging 1.00
R9138:Dlg5 UTSW 14 24245308 missense probably damaging 0.98
R9165:Dlg5 UTSW 14 24146241 missense probably damaging 1.00
R9250:Dlg5 UTSW 14 24190475 missense probably benign 0.07
R9267:Dlg5 UTSW 14 24154677 missense probably damaging 1.00
R9269:Dlg5 UTSW 14 24192813 missense probably damaging 0.99
R9291:Dlg5 UTSW 14 24191161 missense probably damaging 0.99
R9387:Dlg5 UTSW 14 24147100 missense probably damaging 0.99
R9729:Dlg5 UTSW 14 24154613 missense probably benign 0.00
RF005:Dlg5 UTSW 14 24158493 nonsense probably null
YA93:Dlg5 UTSW 14 24155133 unclassified probably benign
Z1088:Dlg5 UTSW 14 24158094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGATGAGCTTGTACTCGCTG -3'
(R):5'- TCAGCTCAACTTCTGGCATTTG -3'

Sequencing Primer
(F):5'- TGTACACAGCATCGCGC -3'
(R):5'- GGCTGAGAAACATTCCAGGCC -3'
Posted On 2021-04-30