Incidental Mutation 'R8701:Abcc4'
ID 669090
Institutional Source Beutler Lab
Gene Symbol Abcc4
Ensembl Gene ENSMUSG00000032849
Gene Name ATP-binding cassette, sub-family C member 4
Synonyms MOAT-B, MRP4, D630049P08Rik
MMRRC Submission 068555-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8701 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 118720104-118943631 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118836785 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 659 (I659V)
Ref Sequence ENSEMBL: ENSMUSP00000042186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036554] [ENSMUST00000166646]
AlphaFold E9Q236
Predicted Effect probably benign
Transcript: ENSMUST00000036554
AA Change: I659V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042186
Gene: ENSMUSG00000032849
AA Change: I659V

DomainStartEndE-ValueType
Pfam:ABC_membrane 92 365 4.5e-37 PFAM
AAA 437 610 5.71e-12 SMART
Pfam:ABC_membrane 714 993 4.2e-47 PFAM
AAA 1067 1251 2.02e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166646
AA Change: I584V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129677
Gene: ENSMUSG00000032849
AA Change: I584V

DomainStartEndE-ValueType
Pfam:ABC_membrane 98 290 4.1e-22 PFAM
AAA 362 535 5.71e-12 SMART
Pfam:ABC_membrane 638 922 4.6e-39 PFAM
AAA 992 1176 2.02e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This family member plays a role in cellular detoxification as a pump for its substrate, organic anions. It may also function in prostaglandin-mediated cAMP signaling in ciliogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice are viable and fertile. Homozygotes for one null allele display impaired organic anion transport in the blood-brain and blood-cerebrospinal fluid barriers and kidney. Homozygotes for a second null allele display hypoalgesia and abnormal PGE2 physiology. [provided by MGI curators]
Allele List at MGI

All alleles(143) : Targeted, knock-out(2) Gene trapped(141)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 T A 3: 95,592,276 (GRCm39) D24V possibly damaging Het
Agtr1b A T 3: 20,370,256 (GRCm39) F117I probably damaging Het
Aldh3b2 A G 19: 4,028,448 (GRCm39) E116G probably damaging Het
Alox5 T A 6: 116,390,787 (GRCm39) I455F possibly damaging Het
Arnt C T 3: 95,401,076 (GRCm39) S675F possibly damaging Het
Camkv A G 9: 107,825,240 (GRCm39) T414A possibly damaging Het
Ccn5 G T 2: 163,670,786 (GRCm39) G98W probably damaging Het
Cd209c C T 8: 3,995,892 (GRCm39) R6H probably benign Het
Cip2a T A 16: 48,827,504 (GRCm39) Y456* probably null Het
Cnr1 A G 4: 33,944,739 (GRCm39) I376V probably benign Het
Cyp2j12 T A 4: 96,009,810 (GRCm39) K183M possibly damaging Het
Dact3 G T 7: 16,619,201 (GRCm39) R232L probably damaging Het
Dlg5 G A 14: 24,226,768 (GRCm39) T378M probably benign Het
Dnah10 T A 5: 124,803,911 (GRCm39) D79E probably benign Het
Dsc1 A T 18: 20,240,739 (GRCm39) Y195* probably null Het
Elovl1 A T 4: 118,287,707 (GRCm39) M1L probably benign Het
Fam107a A G 14: 8,298,755 (GRCm38) F124L probably damaging Het
Fam219a A G 4: 41,520,283 (GRCm39) M155T probably damaging Het
Gm28308 C G 6: 52,140,430 (GRCm39) probably benign Het
Gpr153 C T 4: 152,363,558 (GRCm39) probably benign Het
Gtf2ird2 T A 5: 134,245,077 (GRCm39) I445N probably damaging Het
Gzmb A T 14: 56,497,817 (GRCm39) V141E probably benign Het
Hmcn1 A T 1: 150,631,008 (GRCm39) M930K probably benign Het
Hunk T A 16: 90,183,498 (GRCm39) F52Y probably damaging Het
Il18rap A G 1: 40,578,501 (GRCm39) E304G probably benign Het
Klk14 A G 7: 43,343,566 (GRCm39) S133G possibly damaging Het
Man2b1 T C 8: 85,821,782 (GRCm39) S695P probably damaging Het
Mccc1 A T 3: 36,049,933 (GRCm39) D86E probably benign Het
Mcu T A 10: 59,303,475 (GRCm39) I121F probably damaging Het
Mlxipl T C 5: 135,136,045 (GRCm39) F90S possibly damaging Het
Muc2 A G 7: 141,281,850 (GRCm39) D536G probably damaging Het
Naa11 T C 5: 97,539,817 (GRCm39) S114G possibly damaging Het
Ncaph T C 2: 126,948,058 (GRCm39) K676E probably benign Het
Neurl2 C T 2: 164,675,054 (GRCm39) D103N probably benign Het
Nup210l T C 3: 90,030,121 (GRCm39) M278T probably benign Het
Or10g6 A G 9: 39,933,815 (GRCm39) N42S probably damaging Het
Or4p4 A G 2: 88,482,831 (GRCm39) I112V possibly damaging Het
Or51r1 A T 7: 102,227,899 (GRCm39) M66L possibly damaging Het
Or8c19-ps1 A T 9: 38,220,734 (GRCm39) L214F unknown Het
Or8g4 A T 9: 39,662,210 (GRCm39) H176L probably damaging Het
Pcdh20 A T 14: 88,705,849 (GRCm39) Y484N possibly damaging Het
Pkhd1l1 A G 15: 44,438,079 (GRCm39) Y3598C probably damaging Het
Plcg2 T A 8: 118,308,416 (GRCm39) L336Q probably damaging Het
Ppp1r8 T C 4: 132,557,953 (GRCm39) D207G possibly damaging Het
Prdm13 C T 4: 21,678,615 (GRCm39) C625Y probably damaging Het
Ptcd3 T C 6: 71,862,495 (GRCm39) D480G possibly damaging Het
Rbm39 T A 2: 156,003,507 (GRCm39) K291M probably damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rnf220 T C 4: 117,347,190 (GRCm39) H74R probably damaging Het
Sp6 A T 11: 96,913,090 (GRCm39) T268S probably damaging Het
Spata31e2 A T 1: 26,724,526 (GRCm39) V218D probably benign Het
Sphk2 A T 7: 45,360,249 (GRCm39) V585E probably damaging Het
Syne1 G A 10: 5,155,026 (GRCm39) Q5638* probably null Het
Tas1r3 C T 4: 155,945,503 (GRCm39) V573I probably benign Het
Tdrd1 T C 19: 56,839,916 (GRCm39) S659P possibly damaging Het
Tead4 T A 6: 128,219,529 (GRCm39) K237N probably damaging Het
Tex24 T A 8: 27,835,152 (GRCm39) C227S probably benign Het
Tom1 A T 8: 75,778,796 (GRCm39) T174S probably benign Het
Tpm3 C T 3: 89,994,987 (GRCm39) R168C possibly damaging Het
Trpv3 A G 11: 73,169,762 (GRCm39) E111G possibly damaging Het
Unc80 A G 1: 66,677,191 (GRCm39) D2040G possibly damaging Het
Usp47 A G 7: 111,692,402 (GRCm39) T955A probably damaging Het
Vmn2r11 G A 5: 109,195,556 (GRCm39) A590V probably damaging Het
Zfp112 A G 7: 23,825,165 (GRCm39) R382G probably damaging Het
Zfp606 T A 7: 12,215,025 (GRCm39) D84E unknown Het
Other mutations in Abcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Abcc4 APN 14 118,766,409 (GRCm39) missense probably benign 0.03
IGL01152:Abcc4 APN 14 118,836,797 (GRCm39) missense probably damaging 1.00
IGL01511:Abcc4 APN 14 118,836,753 (GRCm39) missense probably benign 0.03
IGL01604:Abcc4 APN 14 118,765,406 (GRCm39) missense possibly damaging 0.94
IGL01725:Abcc4 APN 14 118,738,241 (GRCm39) missense probably damaging 1.00
IGL01828:Abcc4 APN 14 118,790,691 (GRCm39) splice site probably benign
IGL02174:Abcc4 APN 14 118,738,154 (GRCm39) missense probably damaging 0.98
IGL02391:Abcc4 APN 14 118,790,764 (GRCm39) missense probably damaging 1.00
IGL02500:Abcc4 APN 14 118,856,338 (GRCm39) missense possibly damaging 0.47
IGL02598:Abcc4 APN 14 118,905,781 (GRCm39) nonsense probably null
IGL02668:Abcc4 APN 14 118,848,887 (GRCm39) missense probably damaging 1.00
IGL02708:Abcc4 APN 14 118,738,213 (GRCm39) missense probably damaging 1.00
IGL02859:Abcc4 APN 14 118,753,912 (GRCm39) missense probably damaging 1.00
IGL03249:Abcc4 APN 14 118,865,118 (GRCm39) splice site probably benign
IGL03257:Abcc4 APN 14 118,852,623 (GRCm39) missense probably benign 0.01
IGL03298:Abcc4 APN 14 118,848,880 (GRCm39) missense probably damaging 1.00
1mM(1):Abcc4 UTSW 14 118,867,068 (GRCm39) nonsense probably null
R0743:Abcc4 UTSW 14 118,790,700 (GRCm39) missense possibly damaging 0.90
R0884:Abcc4 UTSW 14 118,790,700 (GRCm39) missense possibly damaging 0.90
R1139:Abcc4 UTSW 14 118,738,252 (GRCm39) missense possibly damaging 0.56
R1238:Abcc4 UTSW 14 118,835,051 (GRCm39) splice site probably benign
R1588:Abcc4 UTSW 14 118,771,484 (GRCm39) missense probably benign 0.01
R1678:Abcc4 UTSW 14 118,832,306 (GRCm39) missense probably benign 0.08
R1785:Abcc4 UTSW 14 118,790,761 (GRCm39) missense probably damaging 0.99
R1786:Abcc4 UTSW 14 118,790,761 (GRCm39) missense probably damaging 0.99
R1961:Abcc4 UTSW 14 118,848,871 (GRCm39) missense possibly damaging 0.92
R1961:Abcc4 UTSW 14 118,848,868 (GRCm39) missense probably damaging 0.98
R1993:Abcc4 UTSW 14 118,763,694 (GRCm39) missense probably benign 0.02
R2025:Abcc4 UTSW 14 118,790,737 (GRCm39) missense probably benign 0.13
R3613:Abcc4 UTSW 14 118,864,863 (GRCm39) critical splice donor site probably null
R3864:Abcc4 UTSW 14 118,853,827 (GRCm39) missense probably benign
R4274:Abcc4 UTSW 14 118,867,034 (GRCm39) missense probably damaging 1.00
R4459:Abcc4 UTSW 14 118,836,805 (GRCm39) missense probably benign 0.11
R4601:Abcc4 UTSW 14 118,869,575 (GRCm39) missense probably benign 0.00
R4665:Abcc4 UTSW 14 118,766,414 (GRCm39) missense probably benign
R4678:Abcc4 UTSW 14 118,865,103 (GRCm39) missense probably damaging 0.97
R4771:Abcc4 UTSW 14 118,721,796 (GRCm39) missense probably benign 0.00
R4962:Abcc4 UTSW 14 118,905,811 (GRCm39) missense probably benign 0.33
R4997:Abcc4 UTSW 14 118,753,915 (GRCm39) nonsense probably null
R5273:Abcc4 UTSW 14 118,832,233 (GRCm39) missense possibly damaging 0.76
R5526:Abcc4 UTSW 14 118,868,449 (GRCm39) missense probably benign 0.10
R5652:Abcc4 UTSW 14 118,856,339 (GRCm39) missense probably benign 0.00
R5820:Abcc4 UTSW 14 118,841,607 (GRCm39) missense probably benign 0.14
R5873:Abcc4 UTSW 14 118,763,702 (GRCm39) missense probably benign 0.00
R6008:Abcc4 UTSW 14 118,727,978 (GRCm39) missense possibly damaging 0.63
R6080:Abcc4 UTSW 14 118,906,462 (GRCm39) missense possibly damaging 0.75
R6222:Abcc4 UTSW 14 118,767,368 (GRCm39) missense probably damaging 1.00
R6919:Abcc4 UTSW 14 118,832,306 (GRCm39) missense probably benign 0.08
R6931:Abcc4 UTSW 14 118,765,400 (GRCm39) missense probably damaging 0.99
R7013:Abcc4 UTSW 14 118,763,755 (GRCm39) missense probably benign
R7055:Abcc4 UTSW 14 118,832,197 (GRCm39) nonsense probably null
R7146:Abcc4 UTSW 14 118,852,593 (GRCm39) missense probably damaging 1.00
R7365:Abcc4 UTSW 14 118,865,066 (GRCm39) missense probably damaging 1.00
R7402:Abcc4 UTSW 14 118,943,487 (GRCm39) missense probably damaging 1.00
R7438:Abcc4 UTSW 14 118,853,858 (GRCm39) missense probably benign 0.01
R7528:Abcc4 UTSW 14 118,767,317 (GRCm39) missense probably damaging 0.99
R7674:Abcc4 UTSW 14 118,848,899 (GRCm39) missense probably damaging 1.00
R7769:Abcc4 UTSW 14 118,852,682 (GRCm39) frame shift probably null
R7823:Abcc4 UTSW 14 118,771,484 (GRCm39) missense probably benign 0.01
R7847:Abcc4 UTSW 14 118,864,892 (GRCm39) missense probably damaging 1.00
R7989:Abcc4 UTSW 14 118,836,772 (GRCm39) missense probably benign 0.05
R8044:Abcc4 UTSW 14 118,852,682 (GRCm39) frame shift probably null
R8214:Abcc4 UTSW 14 118,738,253 (GRCm39) missense probably benign 0.35
R8264:Abcc4 UTSW 14 118,832,254 (GRCm39) missense possibly damaging 0.81
R8309:Abcc4 UTSW 14 118,853,804 (GRCm39) missense probably damaging 1.00
R8369:Abcc4 UTSW 14 118,864,869 (GRCm39) missense probably benign 0.02
R8942:Abcc4 UTSW 14 118,790,732 (GRCm39) missense probably damaging 1.00
R8994:Abcc4 UTSW 14 118,771,556 (GRCm39) critical splice acceptor site probably null
R9008:Abcc4 UTSW 14 118,849,162 (GRCm39) missense probably damaging 0.98
R9100:Abcc4 UTSW 14 118,853,800 (GRCm39) missense possibly damaging 0.65
R9119:Abcc4 UTSW 14 118,868,442 (GRCm39) missense probably benign 0.16
R9267:Abcc4 UTSW 14 118,869,657 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- TAGAGTCGCAGGTCCAACTC -3'
(R):5'- CTGAAGACCAGTTGGCTTTAGC -3'

Sequencing Primer
(F):5'- TCCAGGACAAACGCAGATG -3'
(R):5'- GTGTAGATTTTGGCTCCC -3'
Posted On 2021-04-30