Mutagenetix > Incidental Mutation

Incidental Mutation 'R8701:Dsc1'

669094

Institutional Source

Beutler Lab

Gene Symbol

Dsc1

Ensembl Gene

ENSMUSG00000044322

Gene Name

desmocollin 1

Synonyms

Dsc1a, Dsc1b

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R8701 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20084184-20114871 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 20107682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 195 (Y195*)

Ref Sequence

ENSEMBL: ENSMUSP00000042303 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038710] [ENSMUST00000224432] [ENSMUST00000226115]

AlphaFold

P55849

Predicted Effect

probably null
Transcript: ENSMUST00000038710
AA Change: Y195*

SMART Domains

Protein: ENSMUSP00000042303
Gene: ENSMUSG00000044322
AA Change: Y195*

Domain	Start	End	E-Value	Type
low complexity region	16	26	N/A	INTRINSIC
Cadherin_pro	29	111	2.61e-41	SMART
CA	155	240	2.78e-9	SMART
CA	264	352	5.94e-27	SMART
CA	375	470	5.27e-10	SMART
CA	493	575	1.18e-21	SMART
Blast:CA	593	672	5e-46	BLAST
transmembrane domain	692	714	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000224432
AA Change: Y195*

Predicted Effect

probably benign
Transcript: ENSMUST00000226115

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional protein. Mice lacking the encoded protein exhibit epidermal fragility together with defects of epidermal barrier and differentiation. The neonatal mice lacking the encoded protein exhibit epidermal lesions and older mice develop chronic dermatitis. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants with targeted disruptions of this gene have fragile epidermis, flaky skin, and defects in the epidermal barrier, leading to chronic dermatitis and display abnormal epidermal differentiation as indicated by hyperproliferation and overxpression of keratin 6 and 16. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	A	T	1: 26,685,445	V218D	probably benign	Het
Abcc4	T	C	14: 118,599,373	I659V	probably benign	Het
Adamtsl4	T	A	3: 95,684,966	D24V	possibly damaging	Het
Agtr1b	A	T	3: 20,316,092	F117I	probably damaging	Het
Aldh3b2	A	G	19: 3,978,448	E116G	probably damaging	Het
Alox5	T	A	6: 116,413,826	I455F	possibly damaging	Het
Arnt	C	T	3: 95,493,765	S675F	possibly damaging	Het
C330027C09Rik	T	A	16: 49,007,141	Y456*	probably null	Het
Camkv	A	G	9: 107,948,041	T414A	possibly damaging	Het
Cd209c	C	T	8: 3,945,892	R6H	probably benign	Het
Cnr1	A	G	4: 33,944,739	I376V	probably benign	Het
Cyp2j12	T	A	4: 96,121,573	K183M	possibly damaging	Het
Dact3	G	T	7: 16,885,276	R232L	probably damaging	Het
Dlg5	G	A	14: 24,176,700	T378M	probably benign	Het
Dnah10	T	A	5: 124,726,847	D79E	probably benign	Het
Elovl1	A	T	4: 118,430,510	M1L	probably benign	Het
Fam107a	A	G	14: 8,298,755	F124L	probably damaging	Het
Fam219a	A	G	4: 41,520,283	M155T	probably damaging	Het
Gm28308	C	G	6: 52,163,450		probably benign	Het
Gpr153	C	T	4: 152,279,101		probably benign	Het
Gtf2ird2	T	A	5: 134,216,235	I445N	probably damaging	Het
Gzmb	A	T	14: 56,260,360	V141E	probably benign	Het
Hmcn1	A	T	1: 150,755,257	M930K	probably benign	Het
Hunk	T	A	16: 90,386,610	F52Y	probably damaging	Het
Il18rap	A	G	1: 40,539,341	E304G	probably benign	Het
Klk14	A	G	7: 43,694,142	S133G	possibly damaging	Het
Man2b1	T	C	8: 85,095,153	S695P	probably damaging	Het
Mccc1	A	T	3: 35,995,784	D86E	probably benign	Het
Mcu	T	A	10: 59,467,653	I121F	probably damaging	Het
Mlxipl	T	C	5: 135,107,191	F90S	possibly damaging	Het
Muc2	A	G	7: 141,695,607	D536G	probably damaging	Het
Naa11	T	C	5: 97,391,958	S114G	possibly damaging	Het
Ncaph	T	C	2: 127,106,138	K676E	probably benign	Het
Neurl2	C	T	2: 164,833,134	D103N	probably benign	Het
Nup210l	T	C	3: 90,122,814	M278T	probably benign	Het
Olfr1192-ps1	A	G	2: 88,652,487	I112V	possibly damaging	Het
Olfr550	A	T	7: 102,578,692	M66L	possibly damaging	Het
Olfr897-ps1	A	T	9: 38,309,438	L214F	unknown	Het
Olfr967	A	T	9: 39,750,914	H176L	probably damaging	Het
Olfr981	A	G	9: 40,022,519	N42S	probably damaging	Het
Pcdh20	A	T	14: 88,468,413	Y484N	possibly damaging	Het
Pkhd1l1	A	G	15: 44,574,683	Y3598C	probably damaging	Het
Plcg2	T	A	8: 117,581,677	L336Q	probably damaging	Het
Ppp1r8	T	C	4: 132,830,642	D207G	possibly damaging	Het
Prdm13	C	T	4: 21,678,615	C625Y	probably damaging	Het
Ptcd3	T	C	6: 71,885,511	D480G	possibly damaging	Het
Rbm39	T	A	2: 156,161,587	K291M	probably damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rnf220	T	C	4: 117,489,993	H74R	probably damaging	Het
Sp6	A	T	11: 97,022,264	T268S	probably damaging	Het
Sphk2	A	T	7: 45,710,825	V585E	probably damaging	Het
Syne1	G	A	10: 5,205,026	Q5638*	probably null	Het
Tas1r3	C	T	4: 155,861,046	V573I	probably benign	Het
Tdrd1	T	C	19: 56,851,484	S659P	possibly damaging	Het
Tead4	T	A	6: 128,242,566	K237N	probably damaging	Het
Tex24	T	A	8: 27,345,124	C227S	probably benign	Het
Tom1	A	T	8: 75,052,168	T174S	probably benign	Het
Tpm3	C	T	3: 90,087,680	R168C	possibly damaging	Het
Trpv3	A	G	11: 73,278,936	E111G	possibly damaging	Het
Unc80	A	G	1: 66,638,032	D2040G	possibly damaging	Het
Usp47	A	G	7: 112,093,195	T955A	probably damaging	Het
Vmn2r11	G	A	5: 109,047,690	A590V	probably damaging	Het
Wisp2	G	T	2: 163,828,866	G98W	probably damaging	Het
Zfp112	A	G	7: 24,125,740	R382G	probably damaging	Het
Zfp606	T	A	7: 12,481,098	D84E	unknown	Het

Other mutations in Dsc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Dsc1	APN	18	20101886	missense	probably damaging	1.00
IGL00571:Dsc1	APN	18	20110138	missense	probably damaging	1.00
IGL00790:Dsc1	APN	18	20094896	missense	probably damaging	1.00
IGL00963:Dsc1	APN	18	20111986	missense	probably null	0.01
IGL00972:Dsc1	APN	18	20088363	missense	probably benign	0.32
IGL01112:Dsc1	APN	18	20094622	missense	probably benign	0.02
IGL01458:Dsc1	APN	18	20099138	missense	probably damaging	1.00
IGL01607:Dsc1	APN	18	20089663	missense	probably damaging	1.00
IGL01794:Dsc1	APN	18	20110183	missense	probably damaging	1.00
IGL01959:Dsc1	APN	18	20097225	missense	probably damaging	1.00
IGL02066:Dsc1	APN	18	20108803	unclassified	probably benign
IGL02365:Dsc1	APN	18	20108816	missense	probably damaging	1.00
IGL02714:Dsc1	APN	18	20087485	missense	probably damaging	1.00
IGL02959:Dsc1	APN	18	20108885	missense	probably damaging	1.00
IGL03019:Dsc1	APN	18	20088364	missense	probably benign	0.00
IGL03106:Dsc1	APN	18	20086644	splice site	probably null
R0414:Dsc1	UTSW	18	20088354	missense	possibly damaging	0.85
R0456:Dsc1	UTSW	18	20099112	missense	probably damaging	1.00
R0612:Dsc1	UTSW	18	20114516	missense	probably damaging	0.96
R0630:Dsc1	UTSW	18	20085862	missense	probably damaging	1.00
R0646:Dsc1	UTSW	18	20096057	missense	probably damaging	1.00
R0928:Dsc1	UTSW	18	20110249	splice site	probably null
R0976:Dsc1	UTSW	18	20095041	splice site	probably null
R1221:Dsc1	UTSW	18	20114542	nonsense	probably null
R1398:Dsc1	UTSW	18	20088336	missense	probably damaging	1.00
R1902:Dsc1	UTSW	18	20095988	missense	probably damaging	1.00
R1903:Dsc1	UTSW	18	20095988	missense	probably damaging	1.00
R2070:Dsc1	UTSW	18	20088296	splice site	probably null
R2119:Dsc1	UTSW	18	20110152	missense	probably benign	0.07
R3935:Dsc1	UTSW	18	20097241	missense	probably benign	0.00
R4747:Dsc1	UTSW	18	20094558	missense	probably damaging	1.00
R5034:Dsc1	UTSW	18	20095027	missense	possibly damaging	0.91
R5243:Dsc1	UTSW	18	20099159	missense	probably damaging	1.00
R5289:Dsc1	UTSW	18	20101853	missense	possibly damaging	0.72
R5300:Dsc1	UTSW	18	20094860	missense	probably damaging	1.00
R5354:Dsc1	UTSW	18	20087575	missense	probably damaging	1.00
R5376:Dsc1	UTSW	18	20088446	missense	probably benign	0.21
R5808:Dsc1	UTSW	18	20086829	nonsense	probably null
R5860:Dsc1	UTSW	18	20095024	missense	probably damaging	1.00
R6059:Dsc1	UTSW	18	20110242	missense	probably damaging	0.98
R6116:Dsc1	UTSW	18	20097299	missense	probably benign	0.10
R6351:Dsc1	UTSW	18	20086769	missense	probably damaging	1.00
R6422:Dsc1	UTSW	18	20095033	missense	probably damaging	1.00
R6811:Dsc1	UTSW	18	20089654	missense	probably benign
R6880:Dsc1	UTSW	18	20088372	missense	probably damaging	0.99
R6941:Dsc1	UTSW	18	20097189	missense	probably benign	0.00
R6997:Dsc1	UTSW	18	20086644	splice site	probably null
R7255:Dsc1	UTSW	18	20097273	missense	probably benign	0.12
R7456:Dsc1	UTSW	18	20086822	missense	probably benign	0.00
R7492:Dsc1	UTSW	18	20107680	missense	possibly damaging	0.46
R7503:Dsc1	UTSW	18	20085865	missense	probably damaging	1.00
R8030:Dsc1	UTSW	18	20089571	missense	probably benign
R8167:Dsc1	UTSW	18	20097201	missense	probably damaging	1.00
R8444:Dsc1	UTSW	18	20089579	missense	probably benign	0.00
R8928:Dsc1	UTSW	18	20110168	missense	probably benign	0.01
R9133:Dsc1	UTSW	18	20101847	missense	probably benign	0.00
R9144:Dsc1	UTSW	18	20085582	missense	possibly damaging	0.95
R9189:Dsc1	UTSW	18	20099157	missense	possibly damaging	0.52
R9330:Dsc1	UTSW	18	20110157	missense	possibly damaging	0.67
R9372:Dsc1	UTSW	18	20088432	missense	probably damaging	1.00
R9565:Dsc1	UTSW	18	20107734	missense	probably damaging	0.99
R9685:Dsc1	UTSW	18	20099030	missense	possibly damaging	0.88
R9702:Dsc1	UTSW	18	20094628	missense	probably benign	0.06
Z1176:Dsc1	UTSW	18	20114538	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- GCTTCCCTGGTTAAACTAACTGTC -3'
(R):5'- GTGACTTCACACATGGAAGAATG -3'

Sequencing Primer
(F):5'- CAGTCTGGCACCAGTTTATATTG -3'
(R):5'- ACTCCCAAAAGAGACTAGCTTAAG -3'

Posted On

2021-04-30