Incidental Mutation 'R8702:Dck'
ID 669108
Institutional Source Beutler Lab
Gene Symbol Dck
Ensembl Gene ENSMUSG00000029366
Gene Name deoxycytidine kinase
Synonyms
MMRRC Submission 068556-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8702 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 88912872-88931136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 88926272 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 239 (N239K)
Ref Sequence ENSEMBL: ENSMUSP00000031311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031311]
AlphaFold P43346
Predicted Effect probably damaging
Transcript: ENSMUST00000031311
AA Change: N239K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031311
Gene: ENSMUSG00000029366
AA Change: N239K

DomainStartEndE-ValueType
Pfam:dNK 24 258 2.5e-79 PFAM
Meta Mutation Damage Score 0.1738 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased deoxycytidine kinase activity is associated with increased activation of these compounds to cytotoxic nucleoside triphosphate derivatives. DCK is clinically important because of its relationship to drug resistance and sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have profound defects in lymphopoiesis. Thymic T cell number and overall lymphocyte number are greatly reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,297,415 (GRCm39) R501G probably damaging Het
Arhgap10 A G 8: 77,985,732 (GRCm39) F712L probably benign Het
Arhgef10 C A 8: 14,992,638 (GRCm39) A292E probably benign Het
Bub1b T A 2: 118,468,975 (GRCm39) D913E probably benign Het
Cfap61 T C 2: 146,042,710 (GRCm39) I1161T probably benign Het
Cfap91 A G 16: 38,152,674 (GRCm39) Y179H probably benign Het
Col4a3 A T 1: 82,688,700 (GRCm39) T1348S unknown Het
Dmxl1 G A 18: 49,992,202 (GRCm39) R316H probably benign Het
Efl1 A G 7: 82,399,998 (GRCm39) probably null Het
Elac1 G T 18: 73,872,291 (GRCm39) Q235K probably benign Het
Fer1l4 C A 2: 155,861,310 (GRCm39) W1952L probably benign Het
Fyttd1 A G 16: 32,704,529 (GRCm39) K47E probably damaging Het
Gm14418 A T 2: 177,079,015 (GRCm39) Y327N probably damaging Het
Grxcr2 T C 18: 42,131,754 (GRCm39) D105G possibly damaging Het
Iqub A T 6: 24,461,914 (GRCm39) L506H probably damaging Het
Kcnj10 A G 1: 172,197,127 (GRCm39) T214A probably benign Het
Kcp A T 6: 29,482,750 (GRCm39) C1440S probably damaging Het
Lrrtm2 G T 18: 35,346,018 (GRCm39) A428D probably damaging Het
Neb T C 2: 52,085,717 (GRCm39) Y5506C probably damaging Het
Nrros T A 16: 31,966,589 (GRCm39) probably benign Het
Or5d35 T C 2: 87,855,839 (GRCm39) F258L possibly damaging Het
Or6c65 A T 10: 129,604,284 (GRCm39) L306F probably benign Het
Oxct1 T C 15: 4,183,243 (GRCm39) S485P probably benign Het
Pakap C T 4: 57,709,489 (GRCm39) Q145* probably null Het
Pecr G T 1: 72,306,661 (GRCm39) Q207K probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rev3l T A 10: 39,714,465 (GRCm39) Y2396* probably null Het
Serbp1 G T 6: 67,244,156 (GRCm39) D26Y probably damaging Het
Sirt3 A T 7: 140,458,027 (GRCm39) C41S Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Tcaf2 A T 6: 42,619,701 (GRCm39) S109T probably benign Het
Tpd52l2 C T 2: 181,143,749 (GRCm39) H73Y probably damaging Het
Xkr6 G T 14: 64,057,103 (GRCm39) W594L unknown Het
Other mutations in Dck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Dck APN 5 88,922,095 (GRCm39) splice site probably benign
IGL02229:Dck APN 5 88,921,964 (GRCm39) missense probably damaging 1.00
IGL02317:Dck APN 5 88,921,942 (GRCm39) missense probably damaging 1.00
IGL02696:Dck APN 5 88,920,666 (GRCm39) missense probably damaging 1.00
rosa UTSW 5 88,920,582 (GRCm39) missense probably damaging 1.00
R0600:Dck UTSW 5 88,929,080 (GRCm39) missense probably benign 0.01
R2019:Dck UTSW 5 88,921,943 (GRCm39) missense probably damaging 1.00
R2037:Dck UTSW 5 88,920,576 (GRCm39) missense probably damaging 1.00
R2140:Dck UTSW 5 88,920,582 (GRCm39) missense probably damaging 1.00
R2142:Dck UTSW 5 88,920,582 (GRCm39) missense probably damaging 1.00
R4834:Dck UTSW 5 88,920,595 (GRCm39) missense probably damaging 1.00
R9149:Dck UTSW 5 88,913,166 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAGGCTCTGAATGGCTTTTC -3'
(R):5'- GCCTGTACTCTGACCACAAG -3'

Sequencing Primer
(F):5'- CTAGGTAGGGAACTGCTCTTCAAC -3'
(R):5'- TGTACTCTGACCACAAGCTACAC -3'
Posted On 2021-04-30