Incidental Mutation 'R8702:Efl1'
ID 669114
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GTPase 1
Synonyms D7Ertd791e, 6030468D11Rik, 4932434J20Rik, Eftud1
MMRRC Submission 068556-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R8702 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 82297822-82427060 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 82399998 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
AlphaFold Q8C0D5
Predicted Effect probably null
Transcript: ENSMUST00000039881
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179489
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,297,415 (GRCm39) R501G probably damaging Het
Arhgap10 A G 8: 77,985,732 (GRCm39) F712L probably benign Het
Arhgef10 C A 8: 14,992,638 (GRCm39) A292E probably benign Het
Bub1b T A 2: 118,468,975 (GRCm39) D913E probably benign Het
Cfap61 T C 2: 146,042,710 (GRCm39) I1161T probably benign Het
Cfap91 A G 16: 38,152,674 (GRCm39) Y179H probably benign Het
Col4a3 A T 1: 82,688,700 (GRCm39) T1348S unknown Het
Dck T A 5: 88,926,272 (GRCm39) N239K probably damaging Het
Dmxl1 G A 18: 49,992,202 (GRCm39) R316H probably benign Het
Elac1 G T 18: 73,872,291 (GRCm39) Q235K probably benign Het
Fer1l4 C A 2: 155,861,310 (GRCm39) W1952L probably benign Het
Fyttd1 A G 16: 32,704,529 (GRCm39) K47E probably damaging Het
Gm14418 A T 2: 177,079,015 (GRCm39) Y327N probably damaging Het
Grxcr2 T C 18: 42,131,754 (GRCm39) D105G possibly damaging Het
Iqub A T 6: 24,461,914 (GRCm39) L506H probably damaging Het
Kcnj10 A G 1: 172,197,127 (GRCm39) T214A probably benign Het
Kcp A T 6: 29,482,750 (GRCm39) C1440S probably damaging Het
Lrrtm2 G T 18: 35,346,018 (GRCm39) A428D probably damaging Het
Neb T C 2: 52,085,717 (GRCm39) Y5506C probably damaging Het
Nrros T A 16: 31,966,589 (GRCm39) probably benign Het
Or5d35 T C 2: 87,855,839 (GRCm39) F258L possibly damaging Het
Or6c65 A T 10: 129,604,284 (GRCm39) L306F probably benign Het
Oxct1 T C 15: 4,183,243 (GRCm39) S485P probably benign Het
Pakap C T 4: 57,709,489 (GRCm39) Q145* probably null Het
Pecr G T 1: 72,306,661 (GRCm39) Q207K probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rev3l T A 10: 39,714,465 (GRCm39) Y2396* probably null Het
Serbp1 G T 6: 67,244,156 (GRCm39) D26Y probably damaging Het
Sirt3 A T 7: 140,458,027 (GRCm39) C41S Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Tcaf2 A T 6: 42,619,701 (GRCm39) S109T probably benign Het
Tpd52l2 C T 2: 181,143,749 (GRCm39) H73Y probably damaging Het
Xkr6 G T 14: 64,057,103 (GRCm39) W594L unknown Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82,307,319 (GRCm39) missense probably damaging 1.00
IGL00696:Efl1 APN 7 82,301,080 (GRCm39) splice site probably benign
IGL01344:Efl1 APN 7 82,330,688 (GRCm39) splice site probably benign
IGL01871:Efl1 APN 7 82,412,527 (GRCm39) missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82,347,184 (GRCm39) missense probably benign 0.17
IGL02104:Efl1 APN 7 82,307,263 (GRCm39) critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82,335,899 (GRCm39) missense probably benign
IGL02484:Efl1 APN 7 82,332,247 (GRCm39) missense probably damaging 0.98
IGL03140:Efl1 APN 7 82,342,089 (GRCm39) missense probably benign 0.00
IGL03188:Efl1 APN 7 82,320,909 (GRCm39) missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82,307,373 (GRCm39) missense probably benign 0.14
R0148:Efl1 UTSW 7 82,320,878 (GRCm39) missense probably damaging 1.00
R0226:Efl1 UTSW 7 82,342,219 (GRCm39) splice site probably benign
R0638:Efl1 UTSW 7 82,301,095 (GRCm39) missense probably damaging 1.00
R0684:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
R1018:Efl1 UTSW 7 82,412,221 (GRCm39) missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82,320,936 (GRCm39) missense probably damaging 1.00
R1720:Efl1 UTSW 7 82,332,929 (GRCm39) missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82,412,325 (GRCm39) nonsense probably null
R1973:Efl1 UTSW 7 82,412,085 (GRCm39) missense probably damaging 1.00
R2016:Efl1 UTSW 7 82,402,917 (GRCm39) missense probably damaging 1.00
R2124:Efl1 UTSW 7 82,342,121 (GRCm39) missense probably damaging 1.00
R2290:Efl1 UTSW 7 82,426,878 (GRCm39) missense probably damaging 1.00
R2415:Efl1 UTSW 7 82,347,175 (GRCm39) missense probably damaging 1.00
R3545:Efl1 UTSW 7 82,412,018 (GRCm39) missense probably benign 0.00
R3688:Efl1 UTSW 7 82,412,178 (GRCm39) missense probably benign 0.00
R4092:Efl1 UTSW 7 82,412,035 (GRCm39) missense probably benign 0.00
R4207:Efl1 UTSW 7 82,400,024 (GRCm39) missense probably damaging 0.98
R4347:Efl1 UTSW 7 82,347,174 (GRCm39) missense probably damaging 1.00
R4425:Efl1 UTSW 7 82,412,491 (GRCm39) missense probably damaging 0.99
R4816:Efl1 UTSW 7 82,320,927 (GRCm39) missense probably damaging 1.00
R4858:Efl1 UTSW 7 82,320,835 (GRCm39) missense probably damaging 1.00
R5077:Efl1 UTSW 7 82,307,295 (GRCm39) missense probably damaging 1.00
R5185:Efl1 UTSW 7 82,421,707 (GRCm39) missense probably damaging 1.00
R5319:Efl1 UTSW 7 82,323,714 (GRCm39) missense probably damaging 1.00
R5771:Efl1 UTSW 7 82,341,732 (GRCm39) missense probably benign 0.26
R5857:Efl1 UTSW 7 82,412,397 (GRCm39) missense probably benign
R5956:Efl1 UTSW 7 82,301,107 (GRCm39) missense probably damaging 1.00
R6433:Efl1 UTSW 7 82,323,776 (GRCm39) missense probably damaging 1.00
R7131:Efl1 UTSW 7 82,307,272 (GRCm39) missense probably damaging 1.00
R7143:Efl1 UTSW 7 82,411,888 (GRCm39) missense probably damaging 1.00
R7312:Efl1 UTSW 7 82,330,652 (GRCm39) missense probably benign 0.10
R7409:Efl1 UTSW 7 82,347,121 (GRCm39) missense probably damaging 0.98
R7422:Efl1 UTSW 7 82,330,587 (GRCm39) missense probably damaging 1.00
R7453:Efl1 UTSW 7 82,330,675 (GRCm39) missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82,332,257 (GRCm39) missense probably damaging 1.00
R7884:Efl1 UTSW 7 82,307,307 (GRCm39) missense probably damaging 1.00
R7969:Efl1 UTSW 7 82,342,178 (GRCm39) missense probably benign 0.03
R8394:Efl1 UTSW 7 82,411,986 (GRCm39) missense probably benign 0.00
R8924:Efl1 UTSW 7 82,412,161 (GRCm39) missense probably benign 0.03
R9463:Efl1 UTSW 7 82,426,733 (GRCm39) missense probably damaging 1.00
R9762:Efl1 UTSW 7 82,412,596 (GRCm39) missense probably benign 0.09
Z1088:Efl1 UTSW 7 82,342,058 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAGCAAATTTCTGAGGGTTGG -3'
(R):5'- GCCAGCATCACATGTTCTAGG -3'

Sequencing Primer
(F):5'- AACAGGATCTCGCTGTATCG -3'
(R):5'- TAGGAACAGCGCCATCTTACTTGG -3'
Posted On 2021-04-30