Incidental Mutation 'R8702:Efl1'
ID 669114
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GPTase 1
Synonyms 6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock # R8702 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 82648614-82777852 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 82750790 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
AlphaFold Q8C0D5
Predicted Effect probably null
Transcript: ENSMUST00000039881
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179489
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,282,529 R501G probably damaging Het
Arhgap10 A G 8: 77,259,103 F712L probably benign Het
Arhgef10 C A 8: 14,942,638 A292E probably benign Het
Bub1b T A 2: 118,638,494 D913E probably benign Het
Cfap61 T C 2: 146,200,790 I1161T probably benign Het
Col4a3 A T 1: 82,710,979 T1348S unknown Het
Dck T A 5: 88,778,413 N239K probably damaging Het
Dmxl1 G A 18: 49,859,135 R316H probably benign Het
Elac1 G T 18: 73,739,220 Q235K probably benign Het
Fer1l4 C A 2: 156,019,390 W1952L probably benign Het
Fyttd1 A G 16: 32,884,159 K47E probably damaging Het
Gm14418 A T 2: 177,387,222 Y327N probably damaging Het
Grxcr2 T C 18: 41,998,689 D105G possibly damaging Het
Iqub A T 6: 24,461,915 L506H probably damaging Het
Kcnj10 A G 1: 172,369,560 T214A probably benign Het
Kcp A T 6: 29,482,751 C1440S probably damaging Het
Lrrtm2 G T 18: 35,212,965 A428D probably damaging Het
Maats1 A G 16: 38,332,312 Y179H probably benign Het
Neb T C 2: 52,195,705 Y5506C probably damaging Het
Nrros T A 16: 32,147,771 probably benign Het
Olfr1161 T C 2: 88,025,495 F258L possibly damaging Het
Olfr808 A T 10: 129,768,415 L306F probably benign Het
Oxct1 T C 15: 4,153,761 S485P probably benign Het
Palm2 C T 4: 57,709,489 Q145* probably null Het
Pecr G T 1: 72,267,502 Q207K probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rev3l T A 10: 39,838,469 Y2396* probably null Het
Serbp1 G T 6: 67,267,172 D26Y probably damaging Het
Sirt3 A T 7: 140,878,114 C41S Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tcaf2 A T 6: 42,642,767 S109T probably benign Het
Tpd52l2 C T 2: 181,501,956 H73Y probably damaging Het
Xkr6 G T 14: 63,819,654 W594L unknown Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82658111 missense probably damaging 1.00
IGL00696:Efl1 APN 7 82651872 splice site probably benign
IGL01344:Efl1 APN 7 82681480 splice site probably benign
IGL01871:Efl1 APN 7 82763319 missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82697976 missense probably benign 0.17
IGL02104:Efl1 APN 7 82658055 critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82686691 missense probably benign
IGL02484:Efl1 APN 7 82683039 missense probably damaging 0.98
IGL03140:Efl1 APN 7 82692881 missense probably benign 0.00
IGL03188:Efl1 APN 7 82671701 missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82651886 missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82658165 missense probably benign 0.14
R0148:Efl1 UTSW 7 82671670 missense probably damaging 1.00
R0226:Efl1 UTSW 7 82693011 splice site probably benign
R0638:Efl1 UTSW 7 82651887 missense probably damaging 1.00
R0684:Efl1 UTSW 7 82651886 missense probably damaging 1.00
R1018:Efl1 UTSW 7 82763013 missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82671728 missense probably damaging 1.00
R1720:Efl1 UTSW 7 82683721 missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82763117 nonsense probably null
R1973:Efl1 UTSW 7 82762877 missense probably damaging 1.00
R2016:Efl1 UTSW 7 82753709 missense probably damaging 1.00
R2124:Efl1 UTSW 7 82692913 missense probably damaging 1.00
R2290:Efl1 UTSW 7 82777670 missense probably damaging 1.00
R2415:Efl1 UTSW 7 82697967 missense probably damaging 1.00
R3545:Efl1 UTSW 7 82762810 missense probably benign 0.00
R3688:Efl1 UTSW 7 82762970 missense probably benign 0.00
R4092:Efl1 UTSW 7 82762827 missense probably benign 0.00
R4207:Efl1 UTSW 7 82750816 missense probably damaging 0.98
R4347:Efl1 UTSW 7 82697966 missense probably damaging 1.00
R4425:Efl1 UTSW 7 82763283 missense probably damaging 0.99
R4816:Efl1 UTSW 7 82671719 missense probably damaging 1.00
R4858:Efl1 UTSW 7 82671627 missense probably damaging 1.00
R5077:Efl1 UTSW 7 82658087 missense probably damaging 1.00
R5185:Efl1 UTSW 7 82772499 missense probably damaging 1.00
R5319:Efl1 UTSW 7 82674506 missense probably damaging 1.00
R5771:Efl1 UTSW 7 82692524 missense probably benign 0.26
R5857:Efl1 UTSW 7 82763189 missense probably benign
R5956:Efl1 UTSW 7 82651899 missense probably damaging 1.00
R6433:Efl1 UTSW 7 82674568 missense probably damaging 1.00
R7131:Efl1 UTSW 7 82658064 missense probably damaging 1.00
R7143:Efl1 UTSW 7 82762680 missense probably damaging 1.00
R7312:Efl1 UTSW 7 82681444 missense probably benign 0.10
R7409:Efl1 UTSW 7 82697913 missense probably damaging 0.98
R7422:Efl1 UTSW 7 82681379 missense probably damaging 1.00
R7453:Efl1 UTSW 7 82681467 missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82683049 missense probably damaging 1.00
R7884:Efl1 UTSW 7 82658099 missense probably damaging 1.00
R7969:Efl1 UTSW 7 82692970 missense probably benign 0.03
R8394:Efl1 UTSW 7 82762778 missense probably benign 0.00
R8924:Efl1 UTSW 7 82762953 missense probably benign 0.03
R9463:Efl1 UTSW 7 82777525 missense probably damaging 1.00
R9762:Efl1 UTSW 7 82763388 missense probably benign 0.09
Z1088:Efl1 UTSW 7 82692850 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAGCAAATTTCTGAGGGTTGG -3'
(R):5'- GCCAGCATCACATGTTCTAGG -3'

Sequencing Primer
(F):5'- AACAGGATCTCGCTGTATCG -3'
(R):5'- TAGGAACAGCGCCATCTTACTTGG -3'
Posted On 2021-04-30