Incidental Mutation 'R8703:Zfp638'
ID 669145
Institutional Source Beutler Lab
Gene Symbol Zfp638
Ensembl Gene ENSMUSG00000030016
Gene Name zinc finger protein 638
Synonyms Np220, Zfml
MMRRC Submission 068557-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.862) question?
Stock # R8703 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 83844050-83963855 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 83954143 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 1416 (F1416Y)
Ref Sequence ENSEMBL: ENSMUSP00000144989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032088] [ENSMUST00000113835] [ENSMUST00000113836] [ENSMUST00000203324] [ENSMUST00000203891] [ENSMUST00000204751]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000032088
Gene: ENSMUSG00000030016
AA Change: F1416Y

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113835
SMART Domains Protein: ENSMUSP00000109466
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 880 949 9.04e-3 SMART
Blast:RRM_2 984 1052 2e-25 BLAST
low complexity region 1095 1109 N/A INTRINSIC
ZnF_U1 1218 1252 2.84e-8 SMART
ZnF_C2H2 1221 1245 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113836
SMART Domains Protein: ENSMUSP00000109467
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1222 1256 2.84e-8 SMART
ZnF_C2H2 1225 1249 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203324
SMART Domains Protein: ENSMUSP00000145124
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1220 1254 1.7e-10 SMART
ZnF_C2H2 1223 1247 8.9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203891
SMART Domains Protein: ENSMUSP00000144939
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1186 1220 1.7e-10 SMART
ZnF_C2H2 1189 1213 8.9e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204751
AA Change: F1416Y

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144989
Gene: ENSMUSG00000030016
AA Change: F1416Y

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Meta Mutation Damage Score 0.0795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleoplasmic protein. It binds cytidine-rich sequences in double-stranded DNA. This protein has three types of domains: MH1, MH2 (repeated three times) and MH3. It is associated with packaging, transferring, or processing transcripts. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,676,792 (GRCm39) T2013I probably damaging Het
Ak9 A T 10: 41,201,120 (GRCm39) N137Y Het
Apol10b T A 15: 77,472,897 (GRCm39) E52D probably damaging Het
Calr3 A T 8: 73,192,291 (GRCm39) Y128N probably damaging Het
Dnah14 T A 1: 181,493,576 (GRCm39) L1669* probably null Het
Dppa3 A T 6: 122,605,737 (GRCm39) D97V probably damaging Het
Dync1li1 C A 9: 114,552,329 (GRCm39) P490T probably damaging Het
Eya4 A G 10: 23,039,340 (GRCm39) S85P probably benign Het
Fpr-rs4 T A 17: 18,242,332 (GRCm39) I113N probably damaging Het
Fryl T C 5: 73,247,997 (GRCm39) D1040G probably damaging Het
Fsip2 A T 2: 82,821,871 (GRCm39) D5868V probably damaging Het
Gpr75 A C 11: 30,841,890 (GRCm39) Q265P probably damaging Het
Iqcm G T 8: 76,615,271 (GRCm39) G451C probably damaging Het
Lgr5 A G 10: 115,288,610 (GRCm39) L678P probably benign Het
Mcm9 G A 10: 53,506,073 (GRCm39) P67L probably damaging Het
Naalad2 A C 9: 18,290,008 (GRCm39) Y207D probably damaging Het
Nrap C T 19: 56,323,703 (GRCm39) D1325N probably damaging Het
Nup133 A G 8: 124,643,021 (GRCm39) probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or4b1b T A 2: 90,126,837 (GRCm39) I123F probably damaging Het
Or8k28 C A 2: 86,286,244 (GRCm39) V124L possibly damaging Het
Or9i14 G T 19: 13,792,105 (GRCm39) P283H probably damaging Het
Per2 T A 1: 91,351,767 (GRCm39) N913I possibly damaging Het
Rab9 C T X: 165,240,754 (GRCm39) D186N probably benign Het
Reps1 C T 10: 17,968,990 (GRCm39) R183C probably damaging Het
Rims1 A T 1: 22,496,137 (GRCm39) C134S Het
Rpl10-ps3 A G 9: 50,256,184 (GRCm39) S20P probably benign Het
Sash1 C A 10: 8,605,595 (GRCm39) G932C probably damaging Het
Sema4d T C 13: 51,854,959 (GRCm39) Q46R Het
Sh3d19 A G 3: 86,014,568 (GRCm39) E453G probably damaging Het
Sirt6 A G 10: 81,461,548 (GRCm39) probably benign Het
Sis A T 3: 72,867,657 (GRCm39) F129L probably damaging Het
Skint5 T A 4: 113,733,207 (GRCm39) I399F unknown Het
Slc22a7 T C 17: 46,744,951 (GRCm39) D365G probably damaging Het
Slc6a12 A G 6: 121,324,447 (GRCm39) M38V probably benign Het
Slc9b2 C A 3: 135,031,924 (GRCm39) Y261* probably null Het
Spata21 A G 4: 140,832,218 (GRCm39) I460V probably benign Het
Tes C G 6: 17,099,788 (GRCm39) P261R probably damaging Het
Tex15 T C 8: 34,062,724 (GRCm39) L718P probably benign Het
Tmem135 G A 7: 88,808,170 (GRCm39) A202V probably benign Het
Usp29 T C 7: 6,964,321 (GRCm39) F55L probably benign Het
Usp9y A G Y: 1,356,317 (GRCm39) L1128P probably damaging Het
Zdhhc5 T C 2: 84,520,596 (GRCm39) E527G probably benign Het
Zfand4 A G 6: 116,250,604 (GRCm39) I11M probably damaging Het
Zfp110 T A 7: 12,582,888 (GRCm39) I512K probably benign Het
Other mutations in Zfp638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Zfp638 APN 6 83,956,700 (GRCm39) missense probably damaging 1.00
IGL00514:Zfp638 APN 6 83,933,680 (GRCm39) missense probably damaging 1.00
IGL00705:Zfp638 APN 6 83,954,112 (GRCm39) missense probably damaging 1.00
IGL00785:Zfp638 APN 6 83,906,146 (GRCm39) missense probably damaging 1.00
IGL01068:Zfp638 APN 6 83,911,976 (GRCm39) missense probably damaging 1.00
IGL01084:Zfp638 APN 6 83,921,780 (GRCm39) missense probably benign 0.01
IGL01570:Zfp638 APN 6 83,924,829 (GRCm39) missense probably damaging 1.00
IGL01758:Zfp638 APN 6 83,956,508 (GRCm39) missense probably damaging 0.96
IGL02345:Zfp638 APN 6 83,961,857 (GRCm39) missense probably damaging 1.00
IGL02939:Zfp638 APN 6 83,946,214 (GRCm39) missense probably damaging 0.98
IGL03007:Zfp638 APN 6 83,961,866 (GRCm39) missense probably damaging 1.00
IGL03118:Zfp638 APN 6 83,912,000 (GRCm39) splice site probably benign
IGL03135:Zfp638 APN 6 83,919,857 (GRCm39) missense probably damaging 1.00
IGL03264:Zfp638 APN 6 83,923,229 (GRCm39) missense probably benign 0.04
R0190:Zfp638 UTSW 6 83,905,946 (GRCm39) missense probably damaging 1.00
R0200:Zfp638 UTSW 6 83,944,336 (GRCm39) missense probably damaging 1.00
R0766:Zfp638 UTSW 6 83,906,023 (GRCm39) missense probably damaging 1.00
R0801:Zfp638 UTSW 6 83,949,220 (GRCm39) unclassified probably benign
R0938:Zfp638 UTSW 6 83,961,023 (GRCm39) missense probably benign 0.16
R1312:Zfp638 UTSW 6 83,906,023 (GRCm39) missense probably damaging 1.00
R1458:Zfp638 UTSW 6 83,921,638 (GRCm39) missense probably damaging 1.00
R1584:Zfp638 UTSW 6 83,955,047 (GRCm39) splice site probably null
R1634:Zfp638 UTSW 6 83,956,894 (GRCm39) splice site probably null
R1651:Zfp638 UTSW 6 83,931,719 (GRCm39) missense probably benign 0.00
R2079:Zfp638 UTSW 6 83,930,371 (GRCm39) critical splice donor site probably null
R2134:Zfp638 UTSW 6 83,905,964 (GRCm39) missense probably damaging 1.00
R2142:Zfp638 UTSW 6 83,963,578 (GRCm39) missense probably damaging 1.00
R2201:Zfp638 UTSW 6 83,906,500 (GRCm39) missense probably damaging 1.00
R2422:Zfp638 UTSW 6 83,943,421 (GRCm39) splice site probably benign
R4353:Zfp638 UTSW 6 83,961,041 (GRCm39) missense probably damaging 0.97
R4681:Zfp638 UTSW 6 83,958,719 (GRCm39) missense possibly damaging 0.50
R4716:Zfp638 UTSW 6 83,956,544 (GRCm39) nonsense probably null
R4807:Zfp638 UTSW 6 83,920,040 (GRCm39) missense probably damaging 1.00
R4850:Zfp638 UTSW 6 83,956,457 (GRCm39) missense possibly damaging 0.92
R5079:Zfp638 UTSW 6 83,906,438 (GRCm39) missense probably benign 0.03
R5236:Zfp638 UTSW 6 83,953,557 (GRCm39) nonsense probably null
R5323:Zfp638 UTSW 6 83,939,076 (GRCm39) missense probably damaging 0.96
R5426:Zfp638 UTSW 6 83,953,396 (GRCm39) missense probably damaging 1.00
R5557:Zfp638 UTSW 6 83,944,345 (GRCm39) missense probably damaging 1.00
R5570:Zfp638 UTSW 6 83,956,170 (GRCm39) missense probably damaging 1.00
R5614:Zfp638 UTSW 6 83,906,623 (GRCm39) missense probably damaging 1.00
R5662:Zfp638 UTSW 6 83,920,111 (GRCm39) missense probably damaging 0.97
R5685:Zfp638 UTSW 6 83,906,969 (GRCm39) missense probably damaging 1.00
R5689:Zfp638 UTSW 6 83,906,054 (GRCm39) missense probably damaging 1.00
R5783:Zfp638 UTSW 6 83,921,829 (GRCm39) missense possibly damaging 0.92
R5856:Zfp638 UTSW 6 83,954,047 (GRCm39) missense probably damaging 1.00
R6310:Zfp638 UTSW 6 83,844,212 (GRCm39) missense possibly damaging 0.90
R6477:Zfp638 UTSW 6 83,942,560 (GRCm39) missense probably damaging 1.00
R6557:Zfp638 UTSW 6 83,907,092 (GRCm39) missense probably damaging 1.00
R7084:Zfp638 UTSW 6 83,930,108 (GRCm39) missense possibly damaging 0.50
R7101:Zfp638 UTSW 6 83,931,708 (GRCm39) missense probably benign 0.00
R7141:Zfp638 UTSW 6 83,844,181 (GRCm39) missense unknown
R7368:Zfp638 UTSW 6 83,906,437 (GRCm39) missense possibly damaging 0.60
R7402:Zfp638 UTSW 6 83,905,670 (GRCm39) missense possibly damaging 0.92
R7455:Zfp638 UTSW 6 83,907,127 (GRCm39) missense probably damaging 1.00
R7762:Zfp638 UTSW 6 83,953,254 (GRCm39) missense probably damaging 1.00
R7773:Zfp638 UTSW 6 83,956,196 (GRCm39) missense probably damaging 1.00
R8090:Zfp638 UTSW 6 83,906,801 (GRCm39) missense probably damaging 0.99
R8154:Zfp638 UTSW 6 83,954,391 (GRCm39) missense probably damaging 1.00
R8161:Zfp638 UTSW 6 83,906,713 (GRCm39) missense possibly damaging 0.85
R8327:Zfp638 UTSW 6 83,905,679 (GRCm39) missense probably damaging 0.99
R8384:Zfp638 UTSW 6 83,956,747 (GRCm39) missense probably benign 0.28
R8738:Zfp638 UTSW 6 83,931,745 (GRCm39) critical splice donor site probably null
R8865:Zfp638 UTSW 6 83,954,035 (GRCm39) missense possibly damaging 0.91
R8874:Zfp638 UTSW 6 83,946,135 (GRCm39) missense probably damaging 1.00
R9080:Zfp638 UTSW 6 83,844,155 (GRCm39) missense unknown
R9113:Zfp638 UTSW 6 83,953,894 (GRCm39) missense probably damaging 0.96
R9574:Zfp638 UTSW 6 83,956,680 (GRCm39) missense probably damaging 1.00
R9661:Zfp638 UTSW 6 83,923,320 (GRCm39) missense probably damaging 0.99
R9722:Zfp638 UTSW 6 83,923,301 (GRCm39) missense probably damaging 1.00
R9745:Zfp638 UTSW 6 83,921,795 (GRCm39) missense probably benign 0.27
Z1088:Zfp638 UTSW 6 83,921,793 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTGTAATCAAGGCAGACCC -3'
(R):5'- TCATCCCGTTTCATGATGGG -3'

Sequencing Primer
(F):5'- CCAACTAAAGGAGTGGATCAGACC -3'
(R):5'- CTTTAGAATCCTTGCACTGAAGGGC -3'
Posted On 2021-04-30