Incidental Mutation 'R8703:Iqcm'
ID 669154
Institutional Source Beutler Lab
Gene Symbol Iqcm
Ensembl Gene ENSMUSG00000031620
Gene Name IQ motif containing M
Synonyms 1700007B14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R8703 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 75448694-75984503 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 75888643 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 451 (G451C)
Ref Sequence ENSEMBL: ENSMUSP00000034033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034033] [ENSMUST00000121983] [ENSMUST00000212704]
AlphaFold Q149I8
Predicted Effect probably damaging
Transcript: ENSMUST00000034033
AA Change: G451C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034033
Gene: ENSMUSG00000031620
AA Change: G451C

DomainStartEndE-ValueType
IQ 281 303 2.54e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121983
AA Change: G451C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112901
Gene: ENSMUSG00000031620
AA Change: G451C

DomainStartEndE-ValueType
IQ 281 303 2.54e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212704
AA Change: G451C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,528,673 T2013I probably damaging Het
Ak9 A T 10: 41,325,124 N137Y Het
Apol10b T A 15: 77,588,697 E52D probably damaging Het
Calr3 A T 8: 72,438,447 Y128N probably damaging Het
Dnah14 T A 1: 181,666,011 L1669* probably null Het
Dppa3 A T 6: 122,628,778 D97V probably damaging Het
Dync1li1 C A 9: 114,723,261 P490T probably damaging Het
Eya4 A G 10: 23,163,442 S85P probably benign Het
Fpr-rs4 T A 17: 18,022,070 I113N probably damaging Het
Fryl T C 5: 73,090,654 D1040G probably damaging Het
Fsip2 A T 2: 82,991,527 D5868V probably damaging Het
Gpr75 A C 11: 30,891,890 Q265P probably damaging Het
Lgr5 A G 10: 115,452,705 L678P probably benign Het
Mcm9 G A 10: 53,629,977 P67L probably damaging Het
Naalad2 A C 9: 18,378,712 Y207D probably damaging Het
Nrap C T 19: 56,335,271 D1325N probably damaging Het
Nup133 A G 8: 123,916,282 probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1066 C A 2: 86,455,900 V124L possibly damaging Het
Olfr1272 T A 2: 90,296,493 I123F probably damaging Het
Olfr1499 G T 19: 13,814,741 P283H probably damaging Het
Per2 T A 1: 91,424,045 N913I possibly damaging Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Reps1 C T 10: 18,093,242 R183C probably damaging Het
Rims1 A T 1: 22,425,887 C134S Het
Rpl10-ps3 A G 9: 50,344,884 S20P probably benign Het
Sash1 C A 10: 8,729,831 G932C probably damaging Het
Sema4d T C 13: 51,700,923 Q46R Het
Sh3d19 A G 3: 86,107,261 E453G probably damaging Het
Sirt6 A G 10: 81,625,714 probably benign Het
Sis A T 3: 72,960,324 F129L probably damaging Het
Skint5 T A 4: 113,876,010 I399F unknown Het
Slc22a7 T C 17: 46,434,025 D365G probably damaging Het
Slc6a12 A G 6: 121,347,488 M38V probably benign Het
Slc9b2 C A 3: 135,326,163 Y261* probably null Het
Spata21 A G 4: 141,104,907 I460V probably benign Het
Tes C G 6: 17,099,789 P261R probably damaging Het
Tex15 T C 8: 33,572,696 L718P probably benign Het
Tmem135 G A 7: 89,158,962 A202V probably benign Het
Usp29 T C 7: 6,961,322 F55L probably benign Het
Usp9y A G Y: 1,356,317 L1128P probably damaging Het
Zdhhc5 T C 2: 84,690,252 E527G probably benign Het
Zfand4 A G 6: 116,273,643 I11M probably damaging Het
Zfp110 T A 7: 12,848,961 I512K probably benign Het
Zfp638 T A 6: 83,977,161 F1416Y probably damaging Het
Other mutations in Iqcm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Iqcm APN 8 75888560 missense probably damaging 1.00
IGL02835:Iqcm APN 8 75554883 utr 5 prime probably benign
R0056:Iqcm UTSW 8 75753386 missense probably benign
R2146:Iqcm UTSW 8 75888613 missense probably damaging 1.00
R2910:Iqcm UTSW 8 75714776 missense probably benign
R3801:Iqcm UTSW 8 75669393 missense possibly damaging 0.59
R3804:Iqcm UTSW 8 75669393 missense possibly damaging 0.59
R3834:Iqcm UTSW 8 75577752 missense possibly damaging 0.93
R3897:Iqcm UTSW 8 75753400 missense probably damaging 1.00
R4447:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4448:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4450:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4687:Iqcm UTSW 8 75762989 missense probably damaging 1.00
R4810:Iqcm UTSW 8 75888653 missense probably damaging 1.00
R4845:Iqcm UTSW 8 75746352 missense probably damaging 0.99
R4856:Iqcm UTSW 8 75888600 missense possibly damaging 0.95
R4886:Iqcm UTSW 8 75888600 missense possibly damaging 0.95
R5063:Iqcm UTSW 8 75746286 missense probably damaging 1.00
R5460:Iqcm UTSW 8 75714789 missense probably benign
R6403:Iqcm UTSW 8 75577996 critical splice donor site probably null
R6667:Iqcm UTSW 8 75753352 missense probably damaging 1.00
R7187:Iqcm UTSW 8 75753416 missense probably benign 0.22
R7263:Iqcm UTSW 8 75763073 missense probably benign
R7701:Iqcm UTSW 8 75554911 missense probably benign 0.02
R7916:Iqcm UTSW 8 75577950 missense probably benign
R7938:Iqcm UTSW 8 75577968 missense probably benign
R7974:Iqcm UTSW 8 75554892 start codon destroyed probably null 0.66
R8039:Iqcm UTSW 8 75763105 missense probably damaging 1.00
R9175:Iqcm UTSW 8 75984239 missense possibly damaging 0.84
RF002:Iqcm UTSW 8 75577899 missense probably benign 0.01
X0018:Iqcm UTSW 8 75984212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGATGCAGGTCAATCCATGTTTTG -3'
(R):5'- TTCTACAACACTAGTGAGAGCAC -3'

Sequencing Primer
(F):5'- CTCTCTTACAGATGGTCAAGG -3'
(R):5'- GTGAGAGCACAAAAGCACAAAAC -3'
Posted On 2021-04-30