Incidental Mutation 'R8703:Fpr-rs4'
ID 669170
Institutional Source Beutler Lab
Gene Symbol Fpr-rs4
Ensembl Gene ENSMUSG00000048062
Gene Name formyl peptide receptor, related sequence 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock # R8703 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 18021733-18022704 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18022070 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 113 (I113N)
Ref Sequence ENSEMBL: ENSMUSP00000093311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095651]
AlphaFold A4FUQ5
Predicted Effect probably damaging
Transcript: ENSMUST00000095651
AA Change: I113N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093311
Gene: ENSMUSG00000048062
AA Change: I113N

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 4.9e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,528,673 T2013I probably damaging Het
Ak9 A T 10: 41,325,124 N137Y Het
Apol10b T A 15: 77,588,697 E52D probably damaging Het
Calr3 A T 8: 72,438,447 Y128N probably damaging Het
Dnah14 T A 1: 181,666,011 L1669* probably null Het
Dppa3 A T 6: 122,628,778 D97V probably damaging Het
Dync1li1 C A 9: 114,723,261 P490T probably damaging Het
Eya4 A G 10: 23,163,442 S85P probably benign Het
Fryl T C 5: 73,090,654 D1040G probably damaging Het
Fsip2 A T 2: 82,991,527 D5868V probably damaging Het
Gpr75 A C 11: 30,891,890 Q265P probably damaging Het
Iqcm G T 8: 75,888,643 G451C probably damaging Het
Lgr5 A G 10: 115,452,705 L678P probably benign Het
Mcm9 G A 10: 53,629,977 P67L probably damaging Het
Naalad2 A C 9: 18,378,712 Y207D probably damaging Het
Nrap C T 19: 56,335,271 D1325N probably damaging Het
Nup133 A G 8: 123,916,282 probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1066 C A 2: 86,455,900 V124L possibly damaging Het
Olfr1272 T A 2: 90,296,493 I123F probably damaging Het
Olfr1499 G T 19: 13,814,741 P283H probably damaging Het
Per2 T A 1: 91,424,045 N913I possibly damaging Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Reps1 C T 10: 18,093,242 R183C probably damaging Het
Rims1 A T 1: 22,425,887 C134S Het
Rpl10-ps3 A G 9: 50,344,884 S20P probably benign Het
Sash1 C A 10: 8,729,831 G932C probably damaging Het
Sema4d T C 13: 51,700,923 Q46R Het
Sh3d19 A G 3: 86,107,261 E453G probably damaging Het
Sirt6 A G 10: 81,625,714 probably benign Het
Sis A T 3: 72,960,324 F129L probably damaging Het
Skint5 T A 4: 113,876,010 I399F unknown Het
Slc22a7 T C 17: 46,434,025 D365G probably damaging Het
Slc6a12 A G 6: 121,347,488 M38V probably benign Het
Slc9b2 C A 3: 135,326,163 Y261* probably null Het
Spata21 A G 4: 141,104,907 I460V probably benign Het
Tes C G 6: 17,099,789 P261R probably damaging Het
Tex15 T C 8: 33,572,696 L718P probably benign Het
Tmem135 G A 7: 89,158,962 A202V probably benign Het
Usp29 T C 7: 6,961,322 F55L probably benign Het
Usp9y A G Y: 1,356,317 L1128P probably damaging Het
Zdhhc5 T C 2: 84,690,252 E527G probably benign Het
Zfand4 A G 6: 116,273,643 I11M probably damaging Het
Zfp110 T A 7: 12,848,961 I512K probably benign Het
Zfp638 T A 6: 83,977,161 F1416Y probably damaging Het
Other mutations in Fpr-rs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Fpr-rs4 APN 17 18021926 missense probably damaging 1.00
IGL01064:Fpr-rs4 APN 17 18022517 missense probably damaging 1.00
IGL01626:Fpr-rs4 APN 17 18022231 missense probably damaging 0.97
IGL02544:Fpr-rs4 APN 17 18022211 missense probably benign
IGL02837:Fpr-rs4 UTSW 17 18022251 missense probably benign 0.00
R0179:Fpr-rs4 UTSW 17 18022027 nonsense probably null
R0383:Fpr-rs4 UTSW 17 18022097 missense probably damaging 1.00
R0686:Fpr-rs4 UTSW 17 18022351 missense probably benign 0.05
R1551:Fpr-rs4 UTSW 17 18022327 missense possibly damaging 0.89
R1956:Fpr-rs4 UTSW 17 18022256 missense probably damaging 0.97
R2040:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2041:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2043:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2045:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2048:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2092:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2093:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2136:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R3624:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R4684:Fpr-rs4 UTSW 17 18022184 missense probably damaging 1.00
R6076:Fpr-rs4 UTSW 17 18022055 missense probably damaging 1.00
R6247:Fpr-rs4 UTSW 17 18022486 missense probably benign 0.00
R6639:Fpr-rs4 UTSW 17 18022132 nonsense probably null
R6757:Fpr-rs4 UTSW 17 18022132 nonsense probably null
R9007:Fpr-rs4 UTSW 17 18022154 missense probably damaging 1.00
R9318:Fpr-rs4 UTSW 17 18021955 missense probably benign
R9357:Fpr-rs4 UTSW 17 18021949 missense probably damaging 0.97
R9435:Fpr-rs4 UTSW 17 18022129 missense probably benign 0.00
Z1088:Fpr-rs4 UTSW 17 18021919 missense possibly damaging 0.85
Z1088:Fpr-rs4 UTSW 17 18022694 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CACACTGTGACCACTGTCTC -3'
(R):5'- CTGCTCTTCAGAGGTTGCAACC -3'

Sequencing Primer
(F):5'- GACCACTGTCTCTTATCTGAACTTGG -3'
(R):5'- GGTTGCAACCCAGGATTCAAATTTAG -3'
Posted On 2021-04-30