Incidental Mutation 'R8703:Slc22a7'
ID 669171
Institutional Source Beutler Lab
Gene Symbol Slc22a7
Ensembl Gene ENSMUSG00000067144
Gene Name solute carrier family 22 (organic anion transporter), member 7
Synonyms NLT, OAT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8703 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 46432185-46438477 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46434025 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 365 (D365G)
Ref Sequence ENSEMBL: ENSMUSP00000084234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024764] [ENSMUST00000087012] [ENSMUST00000113465] [ENSMUST00000165993]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024764
SMART Domains Protein: ENSMUSP00000024764
Gene: ENSMUSG00000023968

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087012
AA Change: D365G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084234
Gene: ENSMUSG00000067144
AA Change: D365G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:MFS_1 82 479 1.2e-32 PFAM
Pfam:Sugar_tr 86 524 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113465
SMART Domains Protein: ENSMUSP00000109092
Gene: ENSMUSG00000023968

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165993
SMART Domains Protein: ENSMUSP00000130072
Gene: ENSMUSG00000023968

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the sodium-independent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and appears to be localized to the basolateral membrane of the kidney. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,528,673 T2013I probably damaging Het
Ak9 A T 10: 41,325,124 N137Y Het
Apol10b T A 15: 77,588,697 E52D probably damaging Het
Calr3 A T 8: 72,438,447 Y128N probably damaging Het
Dnah14 T A 1: 181,666,011 L1669* probably null Het
Dppa3 A T 6: 122,628,778 D97V probably damaging Het
Dync1li1 C A 9: 114,723,261 P490T probably damaging Het
Eya4 A G 10: 23,163,442 S85P probably benign Het
Fpr-rs4 T A 17: 18,022,070 I113N probably damaging Het
Fryl T C 5: 73,090,654 D1040G probably damaging Het
Fsip2 A T 2: 82,991,527 D5868V probably damaging Het
Gpr75 A C 11: 30,891,890 Q265P probably damaging Het
Iqcm G T 8: 75,888,643 G451C probably damaging Het
Lgr5 A G 10: 115,452,705 L678P probably benign Het
Mcm9 G A 10: 53,629,977 P67L probably damaging Het
Naalad2 A C 9: 18,378,712 Y207D probably damaging Het
Nrap C T 19: 56,335,271 D1325N probably damaging Het
Nup133 A G 8: 123,916,282 probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1066 C A 2: 86,455,900 V124L possibly damaging Het
Olfr1272 T A 2: 90,296,493 I123F probably damaging Het
Olfr1499 G T 19: 13,814,741 P283H probably damaging Het
Per2 T A 1: 91,424,045 N913I possibly damaging Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Reps1 C T 10: 18,093,242 R183C probably damaging Het
Rims1 A T 1: 22,425,887 C134S Het
Rpl10-ps3 A G 9: 50,344,884 S20P probably benign Het
Sash1 C A 10: 8,729,831 G932C probably damaging Het
Sema4d T C 13: 51,700,923 Q46R Het
Sh3d19 A G 3: 86,107,261 E453G probably damaging Het
Sirt6 A G 10: 81,625,714 probably benign Het
Sis A T 3: 72,960,324 F129L probably damaging Het
Skint5 T A 4: 113,876,010 I399F unknown Het
Slc6a12 A G 6: 121,347,488 M38V probably benign Het
Slc9b2 C A 3: 135,326,163 Y261* probably null Het
Spata21 A G 4: 141,104,907 I460V probably benign Het
Tes C G 6: 17,099,789 P261R probably damaging Het
Tex15 T C 8: 33,572,696 L718P probably benign Het
Tmem135 G A 7: 89,158,962 A202V probably benign Het
Usp29 T C 7: 6,961,322 F55L probably benign Het
Usp9y A G Y: 1,356,317 L1128P probably damaging Het
Zdhhc5 T C 2: 84,690,252 E527G probably benign Het
Zfand4 A G 6: 116,273,643 I11M probably damaging Het
Zfp110 T A 7: 12,848,961 I512K probably benign Het
Zfp638 T A 6: 83,977,161 F1416Y probably damaging Het
Other mutations in Slc22a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Slc22a7 APN 17 46437994 splice site probably null
R0755:Slc22a7 UTSW 17 46438187 missense possibly damaging 0.93
R0898:Slc22a7 UTSW 17 46433149 missense probably damaging 1.00
R1594:Slc22a7 UTSW 17 46438031 missense possibly damaging 0.94
R1794:Slc22a7 UTSW 17 46433153 missense probably damaging 1.00
R1900:Slc22a7 UTSW 17 46438231 missense probably benign 0.00
R1973:Slc22a7 UTSW 17 46437090 missense probably damaging 1.00
R2117:Slc22a7 UTSW 17 46433972 missense possibly damaging 0.55
R4467:Slc22a7 UTSW 17 46432510 missense probably benign
R4739:Slc22a7 UTSW 17 46434997 missense probably damaging 1.00
R4921:Slc22a7 UTSW 17 46436933 missense probably benign 0.00
R6982:Slc22a7 UTSW 17 46434637 missense probably benign 0.02
R7122:Slc22a7 UTSW 17 46438298 missense probably damaging 1.00
R7412:Slc22a7 UTSW 17 46434627 missense probably benign 0.00
R7634:Slc22a7 UTSW 17 46438230 missense probably benign 0.02
R8112:Slc22a7 UTSW 17 46436830 missense probably benign 0.00
R9117:Slc22a7 UTSW 17 46437103 missense probably damaging 1.00
R9541:Slc22a7 UTSW 17 46438158 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTCCTCAGTGAAGGGATG -3'
(R):5'- TGGCCACTGGTACCTACTTG -3'

Sequencing Primer
(F):5'- AGCTGAGTCACCAGACCTG -3'
(R):5'- CCACTGGTACCTACTTGGGGATTATG -3'
Posted On 2021-04-30