Incidental Mutation 'R8704:Gars'
ID669188
Institutional Source Beutler Lab
Gene Symbol Gars
Ensembl Gene ENSMUSG00000029777
Gene Nameglycyl-tRNA synthetase
SynonymsGENA202, Sgrp23, Gena201
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8704 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location55038007-55079500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55063230 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 381 (R381C)
Ref Sequence ENSEMBL: ENSMUSP00000003572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003572]
Predicted Effect probably damaging
Transcript: ENSMUST00000003572
AA Change: R381C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003572
Gene: ENSMUSG00000029777
AA Change: R381C

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
WHEP-TRS 57 112 1.58e-8 SMART
Pfam:tRNA-synt_2b 281 582 2.1e-10 PFAM
Pfam:HGTP_anticodon 605 699 7.7e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.5%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glycyl-tRNA synthetase, one of the aminoacyl-tRNA synthetases that charge tRNAs with their cognate amino acids. The encoded enzyme is an (alpha)2 dimer which belongs to the class II family of tRNA synthetases. It has been shown to be a target of autoantibodies in the human autoimmune diseases, polymyositis or dermatomyositis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: A dominant mutation results in sensory and motor axon degeneration in affected mice, with defects in synaptic transmission, nerve conduction and premature death. A loss of function mutation results in embryonic lethality in homozygous mice, and no discernable phenotype in heterozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,882,663 Q628R possibly damaging Het
Agbl1 G T 7: 76,589,554 probably benign Het
Brf2 A G 8: 27,128,471 V35A possibly damaging Het
Chtf8 A C 8: 106,886,040 M89R probably benign Het
Copa A G 1: 172,104,126 I315V probably benign Het
Csmd2 G A 4: 128,197,354 E229K Het
Etf1 T C 18: 34,906,086 E376G probably damaging Het
Fat2 T A 11: 55,281,311 I2859F probably damaging Het
Foxp1 C G 6: 99,016,546 Q132H unknown Het
Gal3st3 T C 19: 5,302,635 V30A probably benign Het
Gjd3 C T 11: 98,982,619 R133H probably damaging Het
Haspin T C 11: 73,138,002 N87S probably benign Het
Hcrt A T 11: 100,761,926 probably benign Het
Heatr6 T A 11: 83,777,278 M866K probably benign Het
Igf1r T C 7: 68,170,054 probably benign Het
Lgr5 A G 10: 115,452,705 L678P probably benign Het
Lypd5 A G 7: 24,351,557 H31R possibly damaging Het
Mib2 A G 4: 155,659,163 M275T possibly damaging Het
Mmp19 G A 10: 128,798,834 V440I probably benign Het
Nefm T C 14: 68,121,061 E508G unknown Het
Nlrp4a A T 7: 26,457,138 I763L probably benign Het
Olfr1006 T A 2: 85,674,218 H311L Het
Olfr485 A T 7: 108,159,504 V123D possibly damaging Het
Pcdhb1 T A 18: 37,266,349 V451D possibly damaging Het
Pfkfb2 T C 1: 130,698,043 N467D probably benign Het
Ptprc G A 1: 138,115,624 T63I probably benign Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Rhobtb2 G A 14: 69,793,924 P584L probably damaging Het
Rhoc G C 3: 104,792,026 A44P probably damaging Het
Sardh T C 2: 27,230,465 E435G possibly damaging Het
Stfa1 A T 16: 36,285,174 D89V probably damaging Het
Tec T C 5: 72,768,762 K316E probably damaging Het
Tsen15 A T 1: 152,371,790 Y150* probably null Het
Ugt1a5 T C 1: 88,166,365 I105T probably benign Het
Usp25 A G 16: 77,059,290 D257G probably benign Het
Vmn1r195 A G 13: 22,278,888 Y176C possibly damaging Het
Wdr31 G A 4: 62,462,205 A87V probably benign Het
Wwp2 A T 8: 107,485,596 T177S probably benign Het
Zfp28 T C 7: 6,394,638 C691R probably damaging Het
Other mutations in Gars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Gars APN 6 55050353 missense probably damaging 1.00
IGL01084:Gars APN 6 55055827 missense probably benign
IGL01514:Gars APN 6 55065520 missense probably benign 0.01
IGL02104:Gars APN 6 55077697 missense probably damaging 1.00
IGL02349:Gars APN 6 55048064 splice site probably benign
IGL02371:Gars APN 6 55065467 missense probably benign 0.08
IGL02932:Gars APN 6 55060944 missense probably damaging 1.00
BB006:Gars UTSW 6 55063117 missense probably damaging 1.00
BB016:Gars UTSW 6 55063117 missense probably damaging 1.00
IGL02799:Gars UTSW 6 55063099 missense probably damaging 1.00
R0637:Gars UTSW 6 55069487 critical splice donor site probably null
R0762:Gars UTSW 6 55077580 splice site probably null
R1451:Gars UTSW 6 55053123 splice site probably benign
R1846:Gars UTSW 6 55063168 missense probably benign 0.05
R1988:Gars UTSW 6 55077772 missense probably null 0.00
R2033:Gars UTSW 6 55077723 missense probably benign 0.02
R2566:Gars UTSW 6 55065563 missense probably damaging 1.00
R4706:Gars UTSW 6 55069378 missense probably damaging 0.99
R4854:Gars UTSW 6 55046418 missense probably damaging 0.99
R5055:Gars UTSW 6 55068092 missense probably damaging 1.00
R5558:Gars UTSW 6 55065607 missense probably damaging 1.00
R6306:Gars UTSW 6 55055824 missense probably damaging 1.00
R6821:Gars UTSW 6 55079338 missense probably benign 0.00
R7376:Gars UTSW 6 55073359 missense probably benign 0.00
R7505:Gars UTSW 6 55052177 missense probably benign 0.00
R7579:Gars UTSW 6 55077703 missense probably damaging 1.00
R7605:Gars UTSW 6 55077750 missense probably damaging 1.00
R7728:Gars UTSW 6 55050386 missense probably damaging 1.00
R7929:Gars UTSW 6 55063117 missense probably damaging 1.00
R8014:Gars UTSW 6 55073407 missense probably benign
R8391:Gars UTSW 6 55048142 missense probably damaging 1.00
R8418:Gars UTSW 6 55065461 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTTAGGCATGCAGATTTTGATC -3'
(R):5'- ATAGGGACTGGAACTGCAAC -3'

Sequencing Primer
(F):5'- ATCTTGTTTTTCCTTCCAGGGAG -3'
(R):5'- GCAACTTAGAGCTAGGTCACTTGC -3'
Posted On2021-04-30