Incidental Mutation 'R8705:Hyal6'
ID669226
Institutional Source Beutler Lab
Gene Symbol Hyal6
Ensembl Gene ENSMUSG00000029679
Gene Namehyaluronoglucosaminidase 6
Synonyms4932701A20Rik, Hyal-ps1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8705 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location24733245-24745452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24734674 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 202 (R202H)
Ref Sequence ENSEMBL: ENSMUSP00000031690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031690]
Predicted Effect probably benign
Transcript: ENSMUST00000031690
AA Change: R202H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031690
Gene: ENSMUSG00000029679
AA Change: R202H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_56 30 363 4.8e-136 PFAM
EGF 365 438 6.02e0 SMART
transmembrane domain 457 479 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c6 G T 13: 4,434,448 G20W probably damaging Het
Ces1c A G 8: 93,130,890 L21P probably benign Het
Col11a2 G T 17: 34,049,795 G394V unknown Het
Cyp2c70 A G 19: 40,180,504 V113A probably benign Het
Foxp1 C G 6: 99,016,546 Q132H unknown Het
Fras1 A T 5: 96,691,401 D1593V probably benign Het
Frzb G A 2: 80,446,897 probably benign Het
Gas6 T C 8: 13,475,156 D276G probably damaging Het
Gdf7 C T 12: 8,298,167 E377K probably damaging Het
Ggnbp2 A G 11: 84,862,306 F36L possibly damaging Het
Gm40460 A T 7: 142,240,997 C28S unknown Het
Hnrnpd A G 5: 99,963,729 probably benign Het
Hsd17b11 G A 5: 103,992,837 L265F probably benign Het
Igkv5-43 A G 6: 69,823,608 S32P probably benign Het
Kank1 A G 19: 25,411,543 Y860C probably damaging Het
Krt79 G A 15: 101,938,006 T169M probably damaging Het
Lama5 C T 2: 180,178,561 C3296Y probably damaging Het
Ly75 A T 2: 60,318,385 I1200K probably damaging Het
Myo1b A T 1: 51,863,336 Y78* probably null Het
Napb A G 2: 148,700,476 V188A probably benign Het
Neb T C 2: 52,258,783 Y2584C probably damaging Het
Olfr671 T C 7: 104,975,239 I253V possibly damaging Het
P4htm G A 9: 108,580,041 A381V probably damaging Het
Pcdha8 T A 18: 36,993,853 F463I probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phip T C 9: 82,893,559 T1030A probably damaging Het
Phrf1 T A 7: 141,258,738 F615L unknown Het
Prrc2a A G 17: 35,153,566 S1700P possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Sf3b5 G T 10: 13,008,810 R63L probably damaging Het
Sh3rf1 T C 8: 61,349,557 L308P probably damaging Het
Slc7a2 A T 8: 40,914,995 T599S probably damaging Het
Sox5 T C 6: 144,041,286 N184S possibly damaging Het
Traf3 A G 12: 111,242,504 E119G possibly damaging Het
Trim24 T C 6: 37,903,653 probably benign Het
Ubxn11 A T 4: 134,126,240 I368F probably damaging Het
Vmn2r27 C T 6: 124,230,229 G151D probably damaging Het
Wfdc16 T A 2: 164,638,475 R33S possibly damaging Het
Zfp654 A G 16: 64,785,070 V382A possibly damaging Het
Other mutations in Hyal6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Hyal6 APN 6 24734179 missense probably damaging 1.00
IGL02269:Hyal6 APN 6 24740859 missense probably damaging 0.97
IGL02729:Hyal6 APN 6 24734695 missense probably damaging 1.00
IGL02793:Hyal6 APN 6 24734379 nonsense probably null
IGL02943:Hyal6 APN 6 24743439 missense probably damaging 0.99
IGL03351:Hyal6 APN 6 24743429 missense probably damaging 1.00
R0481:Hyal6 UTSW 6 24743418 missense probably damaging 1.00
R0517:Hyal6 UTSW 6 24734853 missense probably benign
R0853:Hyal6 UTSW 6 24734073 missense probably benign
R1182:Hyal6 UTSW 6 24743417 missense probably damaging 1.00
R1401:Hyal6 UTSW 6 24743435 missense probably damaging 1.00
R1780:Hyal6 UTSW 6 24734032 splice site probably benign
R1858:Hyal6 UTSW 6 24740858 missense probably benign 0.01
R2011:Hyal6 UTSW 6 24734724 missense possibly damaging 0.69
R3441:Hyal6 UTSW 6 24734593 missense probably benign
R4819:Hyal6 UTSW 6 24734966 nonsense probably null
R5357:Hyal6 UTSW 6 24734518 missense probably benign 0.05
R5648:Hyal6 UTSW 6 24734236 missense possibly damaging 0.61
R5717:Hyal6 UTSW 6 24743691 missense probably benign 0.15
R5884:Hyal6 UTSW 6 24743369 missense probably damaging 1.00
R6657:Hyal6 UTSW 6 24734758 missense possibly damaging 0.61
R6826:Hyal6 UTSW 6 24734372 missense probably damaging 1.00
R7178:Hyal6 UTSW 6 24734835 missense probably benign 0.28
R7531:Hyal6 UTSW 6 24740787 missense possibly damaging 0.46
R7630:Hyal6 UTSW 6 24734584 missense probably damaging 1.00
R7787:Hyal6 UTSW 6 24743736 missense probably damaging 0.99
R7851:Hyal6 UTSW 6 24734498 missense probably benign 0.05
R8132:Hyal6 UTSW 6 24740828 missense possibly damaging 0.80
R8200:Hyal6 UTSW 6 24734566 missense probably benign 0.01
R8294:Hyal6 UTSW 6 24734379 missense possibly damaging 0.53
R8300:Hyal6 UTSW 6 24734088 missense probably benign
R8509:Hyal6 UTSW 6 24734606 missense probably damaging 1.00
X0019:Hyal6 UTSW 6 24734667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTATAGACTGGGAAGGCTG -3'
(R):5'- GGGCTTCTCTCACTCGGAAATG -3'

Sequencing Primer
(F):5'- CCAGTGGGATAGGAATTGGGGC -3'
(R):5'- CTCTCACTCGGAAATGAACAAATTTC -3'
Posted On2021-04-30