Incidental Mutation 'R8705:Gm40460'
ID669234
Institutional Source Beutler Lab
Gene Symbol Gm40460
Ensembl Gene ENSMUSG00000110324
Gene Namepredicted gene, 40460
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8705 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location142240344-142241078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142240997 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 28 (C28S)
Ref Sequence ENSEMBL: ENSMUSP00000147331 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000211591
AA Change: C28S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c6 G T 13: 4,434,448 G20W probably damaging Het
Ces1c A G 8: 93,130,890 L21P probably benign Het
Col11a2 G T 17: 34,049,795 G394V unknown Het
Cyp2c70 A G 19: 40,180,504 V113A probably benign Het
Foxp1 C G 6: 99,016,546 Q132H unknown Het
Fras1 A T 5: 96,691,401 D1593V probably benign Het
Frzb G A 2: 80,446,897 probably benign Het
Gas6 T C 8: 13,475,156 D276G probably damaging Het
Gdf7 C T 12: 8,298,167 E377K probably damaging Het
Ggnbp2 A G 11: 84,862,306 F36L possibly damaging Het
Hnrnpd A G 5: 99,963,729 probably benign Het
Hsd17b11 G A 5: 103,992,837 L265F probably benign Het
Hyal6 G A 6: 24,734,674 R202H probably benign Het
Igkv5-43 A G 6: 69,823,608 S32P probably benign Het
Kank1 A G 19: 25,411,543 Y860C probably damaging Het
Krt79 G A 15: 101,938,006 T169M probably damaging Het
Lama5 C T 2: 180,178,561 C3296Y probably damaging Het
Ly75 A T 2: 60,318,385 I1200K probably damaging Het
Myo1b A T 1: 51,863,336 Y78* probably null Het
Napb A G 2: 148,700,476 V188A probably benign Het
Neb T C 2: 52,258,783 Y2584C probably damaging Het
Olfr671 T C 7: 104,975,239 I253V possibly damaging Het
P4htm G A 9: 108,580,041 A381V probably damaging Het
Pcdha8 T A 18: 36,993,853 F463I probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phip T C 9: 82,893,559 T1030A probably damaging Het
Phrf1 T A 7: 141,258,738 F615L unknown Het
Prrc2a A G 17: 35,153,566 S1700P possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Sf3b5 G T 10: 13,008,810 R63L probably damaging Het
Sh3rf1 T C 8: 61,349,557 L308P probably damaging Het
Slc7a2 A T 8: 40,914,995 T599S probably damaging Het
Sox5 T C 6: 144,041,286 N184S possibly damaging Het
Traf3 A G 12: 111,242,504 E119G possibly damaging Het
Trim24 T C 6: 37,903,653 probably benign Het
Ubxn11 A T 4: 134,126,240 I368F probably damaging Het
Vmn2r27 C T 6: 124,230,229 G151D probably damaging Het
Wfdc16 T A 2: 164,638,475 R33S possibly damaging Het
Zfp654 A G 16: 64,785,070 V382A possibly damaging Het
Other mutations in Gm40460
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6822:Gm40460 UTSW 7 142240713 small deletion probably benign
R7016:Gm40460 UTSW 7 142240817 small deletion probably benign
R7053:Gm40460 UTSW 7 142240817 small deletion probably benign
R7083:Gm40460 UTSW 7 142240713 small deletion probably benign
R7087:Gm40460 UTSW 7 142240434 small deletion probably benign
R7110:Gm40460 UTSW 7 142240817 small deletion probably benign
R7184:Gm40460 UTSW 7 142240713 small deletion probably benign
R7224:Gm40460 UTSW 7 142240434 small deletion probably benign
R7367:Gm40460 UTSW 7 142240434 small deletion probably benign
R7411:Gm40460 UTSW 7 142240817 small deletion probably benign
R7481:Gm40460 UTSW 7 142240817 small deletion probably benign
R7491:Gm40460 UTSW 7 142240713 small deletion probably benign
R7553:Gm40460 UTSW 7 142240713 small deletion probably benign
R7637:Gm40460 UTSW 7 142240713 small deletion probably benign
R7643:Gm40460 UTSW 7 142240713 small deletion probably benign
R7663:Gm40460 UTSW 7 142240713 small deletion probably benign
R7785:Gm40460 UTSW 7 142240434 small deletion probably benign
R7871:Gm40460 UTSW 7 142240817 small deletion probably benign
R7895:Gm40460 UTSW 7 142240713 small deletion probably benign
R8054:Gm40460 UTSW 7 142240817 small deletion probably benign
R8355:Gm40460 UTSW 7 142240817 small deletion probably benign
R8389:Gm40460 UTSW 7 142240434 small deletion probably benign
R8501:Gm40460 UTSW 7 142240713 small deletion probably benign
R8509:Gm40460 UTSW 7 142240817 small deletion probably benign
R8736:Gm40460 UTSW 7 142240713 small deletion probably benign
R8815:Gm40460 UTSW 7 142240434 small deletion probably benign
R8815:Gm40460 UTSW 7 142240817 small deletion probably benign
R8862:Gm40460 UTSW 7 142240817 small deletion probably benign
R8884:Gm40460 UTSW 7 142240818 nonsense probably null
R8892:Gm40460 UTSW 7 142240713 small deletion probably benign
R8915:Gm40460 UTSW 7 142240713 small deletion probably benign
R8939:Gm40460 UTSW 7 142240434 small deletion probably benign
RF040:Gm40460 UTSW 7 142240817 small deletion probably benign
Z1177:Gm40460 UTSW 7 142240772 missense unknown
Z1177:Gm40460 UTSW 7 142240906 missense unknown
Predicted Primers PCR Primer
(F):5'- CTAGATTGACAGCAGCAGGG -3'
(R):5'- TATAAAGGCCCAGGCTCAGGAG -3'

Sequencing Primer
(F):5'- TTGCAGCAACTGGACTGG -3'
(R):5'- GGAGGCTCCACATCACACTTC -3'
Posted On2021-04-30