Incidental Mutation 'R8705:P4htm'
ID669240
Institutional Source Beutler Lab
Gene Symbol P4htm
Ensembl Gene ENSMUSG00000006675
Gene Nameprolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
SynonymsP4h-tm, 4933406E20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R8705 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108578862-108597667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108580041 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 381 (A381V)
Ref Sequence ENSEMBL: ENSMUSP00000006853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006853] [ENSMUST00000068700] [ENSMUST00000193621]
Predicted Effect probably damaging
Transcript: ENSMUST00000006853
AA Change: A381V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006853
Gene: ENSMUSG00000006675
AA Change: A381V

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
P4Hc 143 460 1.26e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068700
SMART Domains Protein: ENSMUSP00000070927
Gene: ENSMUSG00000066357

DomainStartEndE-ValueType
Blast:WD40 109 142 3e-6 BLAST
WD40 198 237 1.42e-4 SMART
WD40 247 284 7.28e-2 SMART
WD40 286 326 1.72e-3 SMART
Blast:WD40 336 375 3e-13 BLAST
WD40 479 519 2.96e1 SMART
low complexity region 537 552 N/A INTRINSIC
WD40 559 598 1.77e2 SMART
Blast:WD40 600 641 7e-20 BLAST
Blast:WD40 764 815 2e-22 BLAST
Blast:WD40 855 896 2e-11 BLAST
WD40 900 949 1.48e1 SMART
WD40 973 1015 5.52e-2 SMART
WD40 1035 1076 3.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192080
Predicted Effect probably benign
Transcript: ENSMUST00000193621
SMART Domains Protein: ENSMUSP00000141843
Gene: ENSMUSG00000006675

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
Blast:P4Hc 143 211 5e-39 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of prolyl 4-hydroxylases. This protein is a prolyl hydroxylase that may be involved in the degradation of hypoxia-inducible transcription factors under normoxia. It plays a role in adaptation to hypoxia and may be related to cellular oxygen sensing. Alternatively spliced variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased body weight, normal erythropoiesis, and cardioprotection after ischemia-reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c6 G T 13: 4,434,448 G20W probably damaging Het
Ces1c A G 8: 93,130,890 L21P probably benign Het
Col11a2 G T 17: 34,049,795 G394V unknown Het
Cyp2c70 A G 19: 40,180,504 V113A probably benign Het
Foxp1 C G 6: 99,016,546 Q132H unknown Het
Fras1 A T 5: 96,691,401 D1593V probably benign Het
Frzb G A 2: 80,446,897 probably benign Het
Gas6 T C 8: 13,475,156 D276G probably damaging Het
Gdf7 C T 12: 8,298,167 E377K probably damaging Het
Ggnbp2 A G 11: 84,862,306 F36L possibly damaging Het
Gm40460 A T 7: 142,240,997 C28S unknown Het
Hnrnpd A G 5: 99,963,729 probably benign Het
Hsd17b11 G A 5: 103,992,837 L265F probably benign Het
Hyal6 G A 6: 24,734,674 R202H probably benign Het
Igkv5-43 A G 6: 69,823,608 S32P probably benign Het
Kank1 A G 19: 25,411,543 Y860C probably damaging Het
Krt79 G A 15: 101,938,006 T169M probably damaging Het
Lama5 C T 2: 180,178,561 C3296Y probably damaging Het
Ly75 A T 2: 60,318,385 I1200K probably damaging Het
Myo1b A T 1: 51,863,336 Y78* probably null Het
Napb A G 2: 148,700,476 V188A probably benign Het
Neb T C 2: 52,258,783 Y2584C probably damaging Het
Olfr671 T C 7: 104,975,239 I253V possibly damaging Het
Pcdha8 T A 18: 36,993,853 F463I probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phip T C 9: 82,893,559 T1030A probably damaging Het
Phrf1 T A 7: 141,258,738 F615L unknown Het
Prrc2a A G 17: 35,153,566 S1700P possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Sf3b5 G T 10: 13,008,810 R63L probably damaging Het
Sh3rf1 T C 8: 61,349,557 L308P probably damaging Het
Slc7a2 A T 8: 40,914,995 T599S probably damaging Het
Sox5 T C 6: 144,041,286 N184S possibly damaging Het
Traf3 A G 12: 111,242,504 E119G possibly damaging Het
Trim24 T C 6: 37,903,653 probably benign Het
Ubxn11 A T 4: 134,126,240 I368F probably damaging Het
Vmn2r27 C T 6: 124,230,229 G151D probably damaging Het
Wfdc16 T A 2: 164,638,475 R33S possibly damaging Het
Zfp654 A G 16: 64,785,070 V382A possibly damaging Het
Other mutations in P4htm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:P4htm APN 9 108583736 missense probably damaging 1.00
IGL02205:P4htm APN 9 108581962 missense probably benign 0.08
IGL02756:P4htm APN 9 108579778 missense probably damaging 1.00
IGL02802:P4htm UTSW 9 108582856 missense probably benign 0.00
R0605:P4htm UTSW 9 108583724 missense probably null 0.17
R3922:P4htm UTSW 9 108582895 missense probably benign
R4562:P4htm UTSW 9 108581996 missense probably null 1.00
R4730:P4htm UTSW 9 108579772 missense possibly damaging 0.89
R4900:P4htm UTSW 9 108579228 missense probably damaging 1.00
R5027:P4htm UTSW 9 108579293 missense probably benign 0.16
R5124:P4htm UTSW 9 108581942 missense possibly damaging 0.59
R5633:P4htm UTSW 9 108579723 missense probably damaging 1.00
R5877:P4htm UTSW 9 108583733 missense possibly damaging 0.94
R5927:P4htm UTSW 9 108597383 missense probably damaging 1.00
R6163:P4htm UTSW 9 108581951 missense probably damaging 0.99
R6798:P4htm UTSW 9 108582918 missense possibly damaging 0.83
R6920:P4htm UTSW 9 108583613 missense probably benign 0.01
R6962:P4htm UTSW 9 108579195 missense possibly damaging 0.49
R7066:P4htm UTSW 9 108596963 missense probably damaging 0.98
R7183:P4htm UTSW 9 108581860 missense possibly damaging 0.95
R7376:P4htm UTSW 9 108580792 missense probably damaging 0.98
R7506:P4htm UTSW 9 108583679 missense probably damaging 1.00
R7533:P4htm UTSW 9 108596937 missense probably benign 0.02
R7874:P4htm UTSW 9 108596949 missense probably benign 0.01
R8453:P4htm UTSW 9 108580367 unclassified probably benign
Predicted Primers
Posted On2021-04-30