Incidental Mutation 'R8705:Gdf7'
ID 669244
Institutional Source Beutler Lab
Gene Symbol Gdf7
Ensembl Gene ENSMUSG00000037660
Gene Name growth differentiation factor 7
Synonyms BMP12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock # R8705 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 8297918-8301954 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 8298167 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 377 (E377K)
Ref Sequence ENSEMBL: ENSMUSP00000151234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037313] [ENSMUST00000220073]
AlphaFold P43029
Predicted Effect probably damaging
Transcript: ENSMUST00000037313
AA Change: E385K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038301
Gene: ENSMUSG00000037660
AA Change: E385K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 49 275 2.3e-15 PFAM
low complexity region 281 302 N/A INTRINSIC
low complexity region 308 357 N/A INTRINSIC
TGFB 360 461 1.14e-63 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220073
AA Change: E377K

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein may play a role in the differentiation of tendon cells and spinal cord interneurons. Mice lacking a functional copy of this gene exhibit absence of some spinal dopaminergic neurons and brain defects, male sterility, and premature death. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele lack D1A neurons in the dorsal spinal cord; some develop severe hydrocephaly with dilated ventricles and late-onset brain defects. Mice homozygous for another null allele show premature death, hydrocephaly, aberrant seminal vesicle development and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c6 G T 13: 4,434,448 G20W probably damaging Het
Ces1c A G 8: 93,130,890 L21P probably benign Het
Col11a2 G T 17: 34,049,795 G394V unknown Het
Cyp2c70 A G 19: 40,180,504 V113A probably benign Het
Foxp1 C G 6: 99,016,546 Q132H unknown Het
Fras1 A T 5: 96,691,401 D1593V probably benign Het
Frzb G A 2: 80,446,897 probably benign Het
Gas6 T C 8: 13,475,156 D276G probably damaging Het
Ggnbp2 A G 11: 84,862,306 F36L possibly damaging Het
Gm40460 A T 7: 142,240,997 C28S unknown Het
Hnrnpd A G 5: 99,963,729 probably benign Het
Hsd17b11 G A 5: 103,992,837 L265F probably benign Het
Hyal6 G A 6: 24,734,674 R202H probably benign Het
Igkv5-43 A G 6: 69,823,608 S32P probably benign Het
Kank1 A G 19: 25,411,543 Y860C probably damaging Het
Krt79 G A 15: 101,938,006 T169M probably damaging Het
Lama5 C T 2: 180,178,561 C3296Y probably damaging Het
Ly75 A T 2: 60,318,385 I1200K probably damaging Het
Myo1b A T 1: 51,863,336 Y78* probably null Het
Napb A G 2: 148,700,476 V188A probably benign Het
Neb T C 2: 52,258,783 Y2584C probably damaging Het
Olfr671 T C 7: 104,975,239 I253V possibly damaging Het
P4htm G A 9: 108,580,041 A381V probably damaging Het
Pcdha8 T A 18: 36,993,853 F463I probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phip T C 9: 82,893,559 T1030A probably damaging Het
Phrf1 T A 7: 141,258,738 F615L unknown Het
Prrc2a A G 17: 35,153,566 S1700P possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Sf3b5 G T 10: 13,008,810 R63L probably damaging Het
Sh3rf1 T C 8: 61,349,557 L308P probably damaging Het
Slc7a2 A T 8: 40,914,995 T599S probably damaging Het
Sox5 T C 6: 144,041,286 N184S possibly damaging Het
Traf3 A G 12: 111,242,504 E119G possibly damaging Het
Trim24 T C 6: 37,903,653 probably benign Het
Ubxn11 A T 4: 134,126,240 I368F probably damaging Het
Vmn2r27 C T 6: 124,230,229 G151D probably damaging Het
Wfdc16 T A 2: 164,638,475 R33S possibly damaging Het
Zfp654 A G 16: 64,785,070 V382A possibly damaging Het
Other mutations in Gdf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02796:Gdf7 UTSW 12 8301666 missense unknown
R0781:Gdf7 UTSW 12 8301555 splice site probably benign
R1457:Gdf7 UTSW 12 8298073 missense probably damaging 0.97
R1556:Gdf7 UTSW 12 8301698 missense unknown
R1643:Gdf7 UTSW 12 8297971 missense probably damaging 1.00
R2010:Gdf7 UTSW 12 8301729 missense unknown
R2439:Gdf7 UTSW 12 8298050 missense probably damaging 1.00
R2899:Gdf7 UTSW 12 8298470 missense unknown
R3894:Gdf7 UTSW 12 8298845 missense unknown
R4854:Gdf7 UTSW 12 8298014 missense probably damaging 0.99
R5207:Gdf7 UTSW 12 8298371 missense unknown
R6199:Gdf7 UTSW 12 8298832 missense unknown
R6583:Gdf7 UTSW 12 8301758 missense unknown
R7687:Gdf7 UTSW 12 8298257 nonsense probably null
R7745:Gdf7 UTSW 12 8301854 missense unknown
R8845:Gdf7 UTSW 12 8298905 missense unknown
R9100:Gdf7 UTSW 12 8298652 missense unknown
Z1176:Gdf7 UTSW 12 8298409 missense unknown
Z1176:Gdf7 UTSW 12 8298578 missense unknown
Predicted Primers PCR Primer
(F):5'- CGGCATCGATGTAGAGAATGC -3'
(R):5'- AAGAGAGTCTGTTCCGGGAG -3'

Sequencing Primer
(F):5'- ATGCTGATGGGACTGAGCC -3'
(R):5'- TGGGTCACGCAAAGCCAAC -3'
Posted On 2021-04-30