Incidental Mutation 'R8706:Ap3b1'
ID 669283
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonyms recombination induced mutation 2, rim2, Hps2, beta3A, AP-3
MMRRC Submission
Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;
Essential gene? Possibly non essential (E-score: 0.441) question?
Stock # R8706 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 94358960-94566317 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 94408845 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
AlphaFold Q9Z1T1
Predicted Effect probably null
Transcript: ENSMUST00000022196
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Meta Mutation Damage Score 0.9598 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,776 K370E probably benign Het
Adpgk C T 9: 59,315,173 T461I probably benign Het
Adra2b A G 2: 127,364,567 T335A probably benign Het
C1rl T C 6: 124,493,232 probably null Het
Ccdc142 A G 6: 83,103,697 E470G probably damaging Het
Ccm2 T A 11: 6,589,447 I163N possibly damaging Het
Cdk5rap2 A T 4: 70,239,325 F1596L probably benign Het
Chrna4 A T 2: 181,037,514 F47I probably damaging Het
Cx3cl1 A G 8: 94,780,248 T294A probably benign Het
Dcun1d4 C T 5: 73,557,315 T275M probably damaging Het
Dpp4 T C 2: 62,378,303 I166V probably benign Het
Dynap C T 18: 70,240,991 E155K unknown Het
Fam171b A G 2: 83,860,520 T276A probably benign Het
Fmo4 G A 1: 162,794,023 Q540* probably null Het
Gtf2i C A 5: 134,249,879 V633F probably damaging Het
Kmt5c G T 7: 4,746,154 R262L probably damaging Het
Lgr5 A G 10: 115,452,705 L678P probably benign Het
Mrps27 T C 13: 99,405,000 V163A probably damaging Het
Myh7b G A 2: 155,611,749 probably null Het
Myo15 A G 11: 60,479,617 T1068A probably benign Het
Ncor2 T C 5: 125,067,946 E369G unknown Het
Neb T A 2: 52,291,314 M1094L probably benign Het
Osbpl10 T C 9: 115,207,620 L228P probably damaging Het
Park2 T C 17: 11,237,585 S99P probably benign Het
Phip T A 9: 82,905,712 R799S possibly damaging Het
Rassf5 G T 1: 131,245,045 T29N probably benign Het
Tmprss11g T A 5: 86,496,545 S147C probably damaging Het
Ttn G A 2: 76,738,790 T27253I probably damaging Het
Vmn1r59 A T 7: 5,454,716 V15E possibly damaging Het
Wnt6 A C 1: 74,782,788 D176A possibly damaging Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94390863 missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94542884 splice site probably benign
IGL01784:Ap3b1 APN 13 94493739 missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94448463 nonsense probably null
IGL02040:Ap3b1 APN 13 94408845 critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94462403 missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94394795 critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94528319 missense unknown
IGL02493:Ap3b1 APN 13 94404020 missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94418091 missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94477021 missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94528327 missense unknown
IGL03033:Ap3b1 APN 13 94448495 missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94455398 missense probably benign 0.00
bella UTSW 13 94528257 missense unknown
bullet_gray UTSW 13 94451086 critical splice donor site probably benign
cuttlefish UTSW 13 94448451 critical splice acceptor site probably null
Gastropod UTSW 13 94542840 missense unknown
razor UTSW 13 94493731 missense unknown
Slime UTSW 13 94404078 missense possibly damaging 0.51
slug UTSW 13 94408845 critical splice donor site probably null
snail UTSW 13 94479885 splice site probably benign
stalk UTSW 13 94472931 critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94479885 splice site probably benign
R0265:Ap3b1 UTSW 13 94493681 missense unknown
R0270:Ap3b1 UTSW 13 94404118 splice site probably benign
R0346:Ap3b1 UTSW 13 94445971 nonsense probably null
R0422:Ap3b1 UTSW 13 94462460 missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94472938 splice site probably benign
R0508:Ap3b1 UTSW 13 94565714 missense unknown
R0764:Ap3b1 UTSW 13 94479879 splice site probably benign
R1506:Ap3b1 UTSW 13 94446143 splice site probably benign
R1593:Ap3b1 UTSW 13 94501927 missense unknown
R1660:Ap3b1 UTSW 13 94408812 missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94493717 missense unknown
R1791:Ap3b1 UTSW 13 94408797 missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94471704 missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94528216 missense unknown
R3031:Ap3b1 UTSW 13 94565643 missense unknown
R3037:Ap3b1 UTSW 13 94445978 critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94565735 missense unknown
R4624:Ap3b1 UTSW 13 94483226 missense unknown
R4626:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94403960 missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94565641 missense unknown
R4847:Ap3b1 UTSW 13 94471779 missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94472805 missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94479849 missense unknown
R5628:Ap3b1 UTSW 13 94477048 missense unknown
R5671:Ap3b1 UTSW 13 94528257 missense unknown
R5677:Ap3b1 UTSW 13 94528196 missense unknown
R5862:Ap3b1 UTSW 13 94547770 missense unknown
R5941:Ap3b1 UTSW 13 94440273 missense probably benign 0.02
R5941:Ap3b1 UTSW 13 94483265 missense probably damaging 0.96
R6043:Ap3b1 UTSW 13 94476993 missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R6212:Ap3b1 UTSW 13 94493699 missense unknown
R6301:Ap3b1 UTSW 13 94528295 missense unknown
R6765:Ap3b1 UTSW 13 94462509 missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94479861 missense unknown
R6888:Ap3b1 UTSW 13 94408791 missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94418142 missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94532034 nonsense probably null
R7422:Ap3b1 UTSW 13 94528165 missense unknown
R7642:Ap3b1 UTSW 13 94477032 missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94528158 splice site probably null
R7867:Ap3b1 UTSW 13 94483263 missense unknown
R8492:Ap3b1 UTSW 13 94394786 missense possibly damaging 0.60
R8749:Ap3b1 UTSW 13 94528217 missense unknown
R8876:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R8889:Ap3b1 UTSW 13 94542840 missense unknown
R8892:Ap3b1 UTSW 13 94542840 missense unknown
R9065:Ap3b1 UTSW 13 94471715 missense probably damaging 1.00
R9152:Ap3b1 UTSW 13 94472931 critical splice donor site probably null
R9152:Ap3b1 UTSW 13 94493731 missense unknown
R9166:Ap3b1 UTSW 13 94471728 missense probably damaging 1.00
R9218:Ap3b1 UTSW 13 94448451 critical splice acceptor site probably null
R9269:Ap3b1 UTSW 13 94404062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCAGCTCTCTTGAAGTTAC -3'
(R):5'- AAGTGAGCCTTCTTCAAGTATGAG -3'

Sequencing Primer
(F):5'- GCTCTCTTGAAGTTACAATACATGGG -3'
(R):5'- ACTCACACTGCTGTAAGGTG -3'
Posted On 2021-04-30