Incidental Mutation 'R8707:Ccdc8'
ID 669301
Institutional Source Beutler Lab
Gene Symbol Ccdc8
Ensembl Gene ENSMUSG00000041117
Gene Name coiled-coil domain containing 8
Synonyms ENSMUSG00000041117
MMRRC Submission 068561-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8707 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 16727827-16731440 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 16729975 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 488 (A488V)
Ref Sequence ENSEMBL: ENSMUSP00000092399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094805]
AlphaFold D3YZV8
Predicted Effect unknown
Transcript: ENSMUST00000094805
AA Change: A488V
SMART Domains Protein: ENSMUSP00000092399
Gene: ENSMUSG00000041117
AA Change: A488V

DomainStartEndE-ValueType
Pfam:PNMA 1 98 1.3e-19 PFAM
low complexity region 166 171 N/A INTRINSIC
internal_repeat_1 207 275 5.53e-5 PROSPERO
low complexity region 297 332 N/A INTRINSIC
low complexity region 335 420 N/A INTRINSIC
low complexity region 430 452 N/A INTRINSIC
low complexity region 458 468 N/A INTRINSIC
low complexity region 478 540 N/A INTRINSIC
internal_repeat_1 566 640 5.53e-5 PROSPERO
low complexity region 646 658 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein functions as a cofactor required for p53-mediated apoptosis following DNA damage, and may also play a role in growth through interactions with the cytoskeletal adaptor protein obscurin-like 1. Mutations in this gene are a cause of 3M syndrome-3 (3M3). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb18 A G 1: 89,920,857 (GRCm39) L140P probably damaging Het
Cfap57 C A 4: 118,450,203 (GRCm39) V640F probably benign Het
Cx3cl1 A T 8: 95,506,375 (GRCm39) T127S probably benign Het
Dars2 A G 1: 160,884,081 (GRCm39) C263R probably damaging Het
Dnajc13 T C 9: 104,069,847 (GRCm39) M1135V probably damaging Het
Echdc2 G A 4: 108,031,028 (GRCm39) R169Q probably damaging Het
Fcgbp C T 7: 27,819,920 (GRCm39) A2549V probably benign Het
Fermt1 G A 2: 132,766,881 (GRCm39) T362I probably benign Het
Fev A G 1: 74,924,316 (GRCm39) probably null Het
Gm57858 T A 3: 36,073,070 (GRCm39) D404V probably damaging Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Igfals C A 17: 25,099,185 (GRCm39) A92E possibly damaging Het
Inppl1 G A 7: 101,478,903 (GRCm39) A33V Het
Kcnc4 A G 3: 107,355,449 (GRCm39) V333A possibly damaging Het
Lgr5 A G 10: 115,288,610 (GRCm39) L678P probably benign Het
Lmntd2 G A 7: 140,791,234 (GRCm39) R393* probably null Het
Lrrc14 T A 15: 76,597,416 (GRCm39) C109S probably benign Het
Ms4a12 A G 19: 11,192,736 (GRCm39) V200A possibly damaging Het
Mtnr1b C A 9: 15,785,809 (GRCm39) probably benign Het
Myh15 G A 16: 48,973,450 (GRCm39) C1240Y probably damaging Het
Naa25 A G 5: 121,552,875 (GRCm39) Y199C probably damaging Het
Pars2 T C 4: 106,510,359 (GRCm39) L47P probably damaging Het
Pik3ap1 G A 19: 41,313,039 (GRCm39) T358I probably damaging Het
Pop1 C T 15: 34,529,349 (GRCm39) T823I probably benign Het
Rad54l A G 4: 115,954,533 (GRCm39) V690A probably benign Het
Setdb2 G A 14: 59,660,907 (GRCm39) Q79* probably null Het
Svep1 C A 4: 58,070,197 (GRCm39) E2530* probably null Het
Synj1 T C 16: 90,752,319 (GRCm39) D1012G probably benign Het
Thbs2 C T 17: 14,911,645 (GRCm39) G11D probably damaging Het
Tmem177 G A 1: 119,838,070 (GRCm39) A203V probably benign Het
Trappc3l A G 10: 33,978,727 (GRCm39) Y177C unknown Het
Ube2d1 T C 10: 71,092,478 (GRCm39) D122G probably benign Het
Vwa5b2 A G 16: 20,412,965 (GRCm39) T116A probably benign Het
Wasf2 T A 4: 132,917,540 (GRCm39) V213E unknown Het
Other mutations in Ccdc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Ccdc8 APN 7 16,729,967 (GRCm39) missense unknown
R0255:Ccdc8 UTSW 7 16,729,582 (GRCm39) missense unknown
R0504:Ccdc8 UTSW 7 16,729,939 (GRCm39) missense unknown
R3843:Ccdc8 UTSW 7 16,729,039 (GRCm39) missense probably damaging 1.00
R5054:Ccdc8 UTSW 7 16,728,970 (GRCm39) missense probably damaging 1.00
R6020:Ccdc8 UTSW 7 16,730,506 (GRCm39) missense probably damaging 0.99
R6045:Ccdc8 UTSW 7 16,729,956 (GRCm39) missense unknown
R6244:Ccdc8 UTSW 7 16,730,176 (GRCm39) missense probably benign 0.04
R6753:Ccdc8 UTSW 7 16,730,562 (GRCm39) nonsense probably null
R7299:Ccdc8 UTSW 7 16,729,956 (GRCm39) missense unknown
R7567:Ccdc8 UTSW 7 16,728,687 (GRCm39) missense probably damaging 1.00
R7623:Ccdc8 UTSW 7 16,730,537 (GRCm39) missense possibly damaging 0.70
R7745:Ccdc8 UTSW 7 16,729,614 (GRCm39) missense unknown
R8310:Ccdc8 UTSW 7 16,729,326 (GRCm39) missense probably damaging 1.00
R8840:Ccdc8 UTSW 7 16,728,642 (GRCm39) missense probably damaging 1.00
R9099:Ccdc8 UTSW 7 16,728,800 (GRCm39) nonsense probably null
R9630:Ccdc8 UTSW 7 16,728,733 (GRCm39) missense possibly damaging 0.91
R9696:Ccdc8 UTSW 7 16,730,087 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CTAACCAGAAGGCAGAGCTTG -3'
(R):5'- TCCTGCCCTGAGATAAGCTG -3'

Sequencing Primer
(F):5'- GCTTGTAGATAGTCCAAGGGC -3'
(R):5'- TGAGATAAGCTGCAGCCTCTAC -3'
Posted On 2021-04-30