Incidental Mutation 'R8707:Setdb2'
ID 669311
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene Name SET domain, bifurcated 2
Synonyms KMT1F, LOC239122
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.510) question?
Stock # R8707 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 59402009-59440884 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 59423458 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 79 (Q79*)
Ref Sequence ENSEMBL: ENSMUSP00000124696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]
AlphaFold Q8C267
Predicted Effect probably null
Transcript: ENSMUST00000095775
AA Change: Q95*
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: Q95*

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111253
AA Change: Q79*
Predicted Effect probably null
Transcript: ENSMUST00000161459
AA Change: Q79*
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: Q79*

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb18 A G 1: 89,993,135 L140P probably damaging Het
Ccdc144b T A 3: 36,018,921 D404V probably damaging Het
Ccdc8 C T 7: 16,996,050 A488V unknown Het
Cfap57 C A 4: 118,593,006 V640F probably benign Het
Cx3cl1 A T 8: 94,779,747 T127S probably benign Het
Dars2 A G 1: 161,056,511 C263R probably damaging Het
Dnajc13 T C 9: 104,192,648 M1135V probably damaging Het
Echdc2 G A 4: 108,173,831 R169Q probably damaging Het
Fcgbp C T 7: 28,120,495 A2549V probably benign Het
Fermt1 G A 2: 132,924,961 T362I probably benign Het
Fev A G 1: 74,885,157 probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Igfals C A 17: 24,880,211 A92E possibly damaging Het
Inppl1 G A 7: 101,829,696 A33V Het
Kcnc4 A G 3: 107,448,133 V333A possibly damaging Het
Lgr5 A G 10: 115,452,705 L678P probably benign Het
Lmntd2 G A 7: 141,211,321 R393* probably null Het
Lrrc14 T A 15: 76,713,216 C109S probably benign Het
Ms4a12 A G 19: 11,215,372 V200A possibly damaging Het
Mtnr1b C A 9: 15,874,513 probably benign Het
Myh15 G A 16: 49,153,087 C1240Y probably damaging Het
Naa25 A G 5: 121,414,812 Y199C probably damaging Het
Pars2 T C 4: 106,653,162 L47P probably damaging Het
Pik3ap1 G A 19: 41,324,600 T358I probably damaging Het
Pop1 C T 15: 34,529,203 T823I probably benign Het
Rad54l A G 4: 116,097,336 V690A probably benign Het
Svep1 C A 4: 58,070,197 E2530* probably null Het
Synj1 T C 16: 90,955,431 D1012G probably benign Het
Thbs2 C T 17: 14,691,383 G11D probably damaging Het
Tmem177 G A 1: 119,910,340 A203V probably benign Het
Trappc3l A G 10: 34,102,731 Y177C unknown Het
Ube2d1 T C 10: 71,256,648 D122G probably benign Het
Vwa5b2 A G 16: 20,594,215 T116A probably benign Het
Wasf2 T A 4: 133,190,229 V213E unknown Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59415792 missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59402293 utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59423436 missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59413490 missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59431158 missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59402315 missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59406744 splice site probably null
R0610:Setdb2 UTSW 14 59417470 missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59406704 missense probably benign 0.40
R0890:Setdb2 UTSW 14 59419220 missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59423496 splice site probably benign
R1355:Setdb2 UTSW 14 59417441 missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59417485 missense probably benign 0.04
R1968:Setdb2 UTSW 14 59419409 missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59419454 missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59426467 missense probably benign 0.00
R3919:Setdb2 UTSW 14 59419167 missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59415704 missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59409359 missense probably benign 0.13
R4816:Setdb2 UTSW 14 59413646 missense probably benign 0.05
R4864:Setdb2 UTSW 14 59409266 missense probably benign 0.01
R4951:Setdb2 UTSW 14 59402303 missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59415707 missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59426494 missense probably null 0.00
R5358:Setdb2 UTSW 14 59409436 missense probably benign 0.17
R5656:Setdb2 UTSW 14 59419118 missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59423365 missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59409532 splice site probably null
R6106:Setdb2 UTSW 14 59423449 nonsense probably null
R6388:Setdb2 UTSW 14 59424697 missense probably benign
R6431:Setdb2 UTSW 14 59419056 missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59402414 missense probably benign 0.12
R6971:Setdb2 UTSW 14 59415740 missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59419251 missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59423345 nonsense probably null
R7759:Setdb2 UTSW 14 59419364 missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59423384 nonsense probably null
R8039:Setdb2 UTSW 14 59402375 missense probably damaging 1.00
R8261:Setdb2 UTSW 14 59413692 splice site probably benign
R8393:Setdb2 UTSW 14 59412731 missense probably benign 0.04
R8513:Setdb2 UTSW 14 59402390 missense probably damaging 1.00
R8700:Setdb2 UTSW 14 59417439 missense probably damaging 1.00
R8940:Setdb2 UTSW 14 59409507 missense probably damaging 1.00
R9217:Setdb2 UTSW 14 59409432 missense possibly damaging 0.61
R9314:Setdb2 UTSW 14 59412791 missense probably benign 0.02
R9336:Setdb2 UTSW 14 59423367 missense unknown
R9442:Setdb2 UTSW 14 59402400 missense probably damaging 1.00
R9525:Setdb2 UTSW 14 59409392 missense probably benign 0.00
R9743:Setdb2 UTSW 14 59413553 missense probably benign 0.00
X0017:Setdb2 UTSW 14 59419468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAATGTCCTCAAAGTTGATTTGG -3'
(R):5'- TATTGGCAATCTTATGGCTGAGTC -3'

Sequencing Primer
(F):5'- TGACTAATAAACACAGACATCGTGAG -3'
(R):5'- TGGCTGAGTCTCAAAATTTTAGTATC -3'
Posted On 2021-04-30