Mutagenetix > Incidental Mutation

Incidental Mutation 'R8707:Setdb2'

669311

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R8707 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 59423458 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 79 (Q79*)

Ref Sequence

ENSEMBL: ENSMUSP00000124696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

probably null
Transcript: ENSMUST00000095775
AA Change: Q95*

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: Q95*

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000111253
AA Change: Q79*

Predicted Effect

probably null
Transcript: ENSMUST00000161459
AA Change: Q79*

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: Q79*

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asb18	A	G	1: 89,993,135	L140P	probably damaging	Het
Ccdc144b	T	A	3: 36,018,921	D404V	probably damaging	Het
Ccdc8	C	T	7: 16,996,050	A488V	unknown	Het
Cfap57	C	A	4: 118,593,006	V640F	probably benign	Het
Cx3cl1	A	T	8: 94,779,747	T127S	probably benign	Het
Dars2	A	G	1: 161,056,511	C263R	probably damaging	Het
Dnajc13	T	C	9: 104,192,648	M1135V	probably damaging	Het
Echdc2	G	A	4: 108,173,831	R169Q	probably damaging	Het
Fcgbp	C	T	7: 28,120,495	A2549V	probably benign	Het
Fermt1	G	A	2: 132,924,961	T362I	probably benign	Het
Fev	A	G	1: 74,885,157		probably null	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Igfals	C	A	17: 24,880,211	A92E	possibly damaging	Het
Inppl1	G	A	7: 101,829,696	A33V		Het
Kcnc4	A	G	3: 107,448,133	V333A	possibly damaging	Het
Lgr5	A	G	10: 115,452,705	L678P	probably benign	Het
Lmntd2	G	A	7: 141,211,321	R393*	probably null	Het
Lrrc14	T	A	15: 76,713,216	C109S	probably benign	Het
Ms4a12	A	G	19: 11,215,372	V200A	possibly damaging	Het
Mtnr1b	C	A	9: 15,874,513		probably benign	Het
Myh15	G	A	16: 49,153,087	C1240Y	probably damaging	Het
Naa25	A	G	5: 121,414,812	Y199C	probably damaging	Het
Pars2	T	C	4: 106,653,162	L47P	probably damaging	Het
Pik3ap1	G	A	19: 41,324,600	T358I	probably damaging	Het
Pop1	C	T	15: 34,529,203	T823I	probably benign	Het
Rad54l	A	G	4: 116,097,336	V690A	probably benign	Het
Svep1	C	A	4: 58,070,197	E2530*	probably null	Het
Synj1	T	C	16: 90,955,431	D1012G	probably benign	Het
Thbs2	C	T	17: 14,691,383	G11D	probably damaging	Het
Tmem177	G	A	1: 119,910,340	A203V	probably benign	Het
Trappc3l	A	G	10: 34,102,731	Y177C	unknown	Het
Ube2d1	T	C	10: 71,256,648	D122G	probably benign	Het
Vwa5b2	A	G	16: 20,594,215	T116A	probably benign	Het
Wasf2	T	A	4: 133,190,229	V213E	unknown	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAATGTCCTCAAAGTTGATTTGG -3'
(R):5'- TATTGGCAATCTTATGGCTGAGTC -3'

Sequencing Primer
(F):5'- TGACTAATAAACACAGACATCGTGAG -3'
(R):5'- TGGCTGAGTCTCAAAATTTTAGTATC -3'

Posted On

2021-04-30