Incidental Mutation 'R8707:Pop1'
ID 669312
Institutional Source Beutler Lab
Gene Symbol Pop1
Ensembl Gene ENSMUSG00000022325
Gene Name processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)
Synonyms 4932434G09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock # R8707 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 34495304-34530648 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34529203 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 823 (T823I)
Ref Sequence ENSEMBL: ENSMUSP00000052654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052290] [ENSMUST00000079028]
AlphaFold Q8K205
Predicted Effect probably benign
Transcript: ENSMUST00000052290
AA Change: T823I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000052654
Gene: ENSMUSG00000022325
AA Change: T823I

DomainStartEndE-ValueType
Pfam:POP1 107 190 6.2e-21 PFAM
Pfam:POP1 179 257 2.5e-23 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 647 738 1.4e-30 PFAM
low complexity region 931 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079028
AA Change: T793I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078037
Gene: ENSMUSG00000022325
AA Change: T793I

DomainStartEndE-ValueType
Pfam:POP1 107 258 1e-46 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 617 708 1.2e-34 PFAM
low complexity region 901 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein subunit of two different small nucleolar ribonucleoprotein complexes: the endoribonuclease for mitochondrial RNA processing complex and the ribonuclease P complex. The encoded protein is a ribonuclease that localizes to the nucleus and functions in pre-RNA processing. This protein is also an autoantigen in patients suffering from connective tissue diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb18 A G 1: 89,993,135 L140P probably damaging Het
Ccdc144b T A 3: 36,018,921 D404V probably damaging Het
Ccdc8 C T 7: 16,996,050 A488V unknown Het
Cfap57 C A 4: 118,593,006 V640F probably benign Het
Cx3cl1 A T 8: 94,779,747 T127S probably benign Het
Dars2 A G 1: 161,056,511 C263R probably damaging Het
Dnajc13 T C 9: 104,192,648 M1135V probably damaging Het
Echdc2 G A 4: 108,173,831 R169Q probably damaging Het
Fcgbp C T 7: 28,120,495 A2549V probably benign Het
Fermt1 G A 2: 132,924,961 T362I probably benign Het
Fev A G 1: 74,885,157 probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Igfals C A 17: 24,880,211 A92E possibly damaging Het
Inppl1 G A 7: 101,829,696 A33V Het
Kcnc4 A G 3: 107,448,133 V333A possibly damaging Het
Lgr5 A G 10: 115,452,705 L678P probably benign Het
Lmntd2 G A 7: 141,211,321 R393* probably null Het
Lrrc14 T A 15: 76,713,216 C109S probably benign Het
Ms4a12 A G 19: 11,215,372 V200A possibly damaging Het
Mtnr1b C A 9: 15,874,513 probably benign Het
Myh15 G A 16: 49,153,087 C1240Y probably damaging Het
Naa25 A G 5: 121,414,812 Y199C probably damaging Het
Pars2 T C 4: 106,653,162 L47P probably damaging Het
Pik3ap1 G A 19: 41,324,600 T358I probably damaging Het
Rad54l A G 4: 116,097,336 V690A probably benign Het
Setdb2 G A 14: 59,423,458 Q79* probably null Het
Svep1 C A 4: 58,070,197 E2530* probably null Het
Synj1 T C 16: 90,955,431 D1012G probably benign Het
Thbs2 C T 17: 14,691,383 G11D probably damaging Het
Tmem177 G A 1: 119,910,340 A203V probably benign Het
Trappc3l A G 10: 34,102,731 Y177C unknown Het
Ube2d1 T C 10: 71,256,648 D122G probably benign Het
Vwa5b2 A G 16: 20,594,215 T116A probably benign Het
Wasf2 T A 4: 133,190,229 V213E unknown Het
Other mutations in Pop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Pop1 APN 15 34508729 missense probably benign 0.00
IGL02192:Pop1 APN 15 34529071 missense probably benign 0.08
IGL02680:Pop1 APN 15 34502473 missense probably damaging 0.99
IGL02958:Pop1 APN 15 34530363 missense probably damaging 0.99
H8562:Pop1 UTSW 15 34530212 missense probably benign 0.00
PIT4802001:Pop1 UTSW 15 34529083 missense probably benign 0.00
R0244:Pop1 UTSW 15 34515891 nonsense probably null
R0281:Pop1 UTSW 15 34529858 splice site probably null
R0453:Pop1 UTSW 15 34526206 missense possibly damaging 0.82
R0579:Pop1 UTSW 15 34509969 missense possibly damaging 0.68
R1054:Pop1 UTSW 15 34509809 missense probably benign 0.30
R1501:Pop1 UTSW 15 34510357 missense probably benign 0.01
R1614:Pop1 UTSW 15 34530210 missense possibly damaging 0.46
R1994:Pop1 UTSW 15 34530471 missense probably damaging 1.00
R2084:Pop1 UTSW 15 34508598 splice site probably benign
R4020:Pop1 UTSW 15 34508780 missense probably benign 0.01
R4550:Pop1 UTSW 15 34528936 missense probably damaging 1.00
R4579:Pop1 UTSW 15 34515824 intron probably benign
R5672:Pop1 UTSW 15 34530179 missense possibly damaging 0.63
R6139:Pop1 UTSW 15 34529058 missense probably benign 0.26
R6161:Pop1 UTSW 15 34526310 missense probably damaging 1.00
R6821:Pop1 UTSW 15 34508639 missense possibly damaging 0.86
R7053:Pop1 UTSW 15 34530275 missense probably benign 0.01
R7195:Pop1 UTSW 15 34510379 missense probably damaging 0.97
R7543:Pop1 UTSW 15 34530447 missense probably damaging 1.00
R7571:Pop1 UTSW 15 34528947 missense probably null 1.00
R7587:Pop1 UTSW 15 34502413 missense probably damaging 0.97
R8401:Pop1 UTSW 15 34508609 missense probably damaging 1.00
R8406:Pop1 UTSW 15 34529170 missense probably benign
R9044:Pop1 UTSW 15 34530408 missense possibly damaging 0.94
R9066:Pop1 UTSW 15 34515914 missense possibly damaging 0.68
R9236:Pop1 UTSW 15 34499412 missense probably damaging 0.98
RF001:Pop1 UTSW 15 34502437 missense probably damaging 1.00
RF002:Pop1 UTSW 15 34502437 missense probably damaging 1.00
Z1088:Pop1 UTSW 15 34499319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAATGCCTGGTGCTCAG -3'
(R):5'- GCCAAGGACAGTATTTTCAACCAC -3'

Sequencing Primer
(F):5'- GGAGACTGACCCAAGACGGC -3'
(R):5'- ATGTATTAAACTGTTTCCCTAGGCC -3'
Posted On 2021-04-30