Incidental Mutation 'R8708:Mdn1'
ID 669344
Institutional Source Beutler Lab
Gene Symbol Mdn1
Ensembl Gene ENSMUSG00000058006
Gene Name midasin AAA ATPase 1
Synonyms 4833432B22Rik, D4Abb1e, LOC213784
MMRRC Submission 068562-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8708 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 32657119-32775217 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 32725854 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 2591 (D2591A)
Ref Sequence ENSEMBL: ENSMUSP00000071569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071642] [ENSMUST00000178134]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071642
AA Change: D2591A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071569
Gene: ENSMUSG00000058006
AA Change: D2591A

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 7.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4672 4681 N/A INTRINSIC
low complexity region 4735 4756 N/A INTRINSIC
low complexity region 4769 4790 N/A INTRINSIC
low complexity region 4886 4905 N/A INTRINSIC
low complexity region 4924 4937 N/A INTRINSIC
coiled coil region 4957 4983 N/A INTRINSIC
low complexity region 5000 5017 N/A INTRINSIC
low complexity region 5176 5192 N/A INTRINSIC
low complexity region 5315 5329 N/A INTRINSIC
VWA 5375 5556 2.73e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178134
AA Change: D2591A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136222
Gene: ENSMUSG00000058006
AA Change: D2591A

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 4.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4667 4676 N/A INTRINSIC
low complexity region 4730 4751 N/A INTRINSIC
low complexity region 4764 4785 N/A INTRINSIC
low complexity region 4881 4900 N/A INTRINSIC
low complexity region 4919 4932 N/A INTRINSIC
coiled coil region 4952 4978 N/A INTRINSIC
low complexity region 4992 5010 N/A INTRINSIC
low complexity region 5169 5185 N/A INTRINSIC
low complexity region 5308 5322 N/A INTRINSIC
VWA 5368 5549 2.73e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (99/101)
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,403,400 (GRCm39) K230R probably damaging Het
Ajm1 C A 2: 25,467,814 (GRCm39) R699L possibly damaging Het
Akp3 T A 1: 87,054,091 (GRCm39) Y236* probably null Het
Alg11 T C 8: 22,555,129 (GRCm39) F130S probably damaging Het
Ankfn1 A T 11: 89,394,756 (GRCm39) S276R possibly damaging Het
Ankhd1 T A 18: 36,727,344 (GRCm39) H486Q probably damaging Het
Ankrd23 T C 1: 36,573,169 (GRCm39) T68A probably benign Het
Arhgap23 A G 11: 97,343,238 (GRCm39) T507A probably benign Het
Arid1a A T 4: 133,409,145 (GRCm39) D1787E unknown Het
Atad2b T A 12: 5,011,253 (GRCm39) D504E probably damaging Het
Atg2b T A 12: 105,635,687 (GRCm39) probably benign Het
Bptf C A 11: 106,964,139 (GRCm39) S1685I probably damaging Het
Bptf T A 11: 106,964,140 (GRCm39) S1685C probably damaging Het
Cacna1c A T 6: 118,604,416 (GRCm39) I1437N Het
Capn1 T C 19: 6,061,328 (GRCm39) K197E probably damaging Het
Ccdc177 T C 12: 80,805,891 (GRCm39) T128A probably benign Het
Ccdc7b G T 8: 129,863,095 (GRCm39) M9I probably benign Het
Celf1 T A 2: 90,840,925 (GRCm39) probably null Het
Ckap5 T A 2: 91,425,823 (GRCm39) N1285K probably benign Het
Col24a1 C T 3: 145,251,020 (GRCm39) T1673I probably damaging Het
Dbp A G 7: 45,359,225 (GRCm39) E300G probably damaging Het
Dchs2 C A 3: 83,036,049 (GRCm39) H265Q probably benign Het
Dicer1 A T 12: 104,694,704 (GRCm39) S198T possibly damaging Het
Dnase1l2 A T 17: 24,661,266 (GRCm39) F86L probably benign Het
Dnhd1 T G 7: 105,343,487 (GRCm39) Y1610* probably null Het
Dock5 A G 14: 68,004,820 (GRCm39) V1529A probably benign Het
Egfr G T 11: 16,817,300 (GRCm39) probably benign Het
Exph5 T A 9: 53,287,096 (GRCm39) H1392Q probably benign Het
Fam78b A G 1: 166,906,332 (GRCm39) K164E possibly damaging Het
Fignl2 C A 15: 100,950,734 (GRCm39) R516L unknown Het
Fndc7 C T 3: 108,774,528 (GRCm39) E577K probably benign Het
Fryl T C 5: 73,289,905 (GRCm39) E107G probably benign Het
Gbp10 A T 5: 105,368,831 (GRCm39) M336K probably damaging Het
Gm11444 A T 11: 85,737,723 (GRCm39) C156S Het
Golga3 C A 5: 110,350,721 (GRCm39) A752E probably benign Het
Gper1 G T 5: 139,411,690 (GRCm39) V12L probably benign Het
Hmbox1 G T 14: 65,061,089 (GRCm39) A394E probably damaging Het
Ighv1-71 T A 12: 115,705,955 (GRCm39) I77L probably benign Het
Ing4 A T 6: 125,024,895 (GRCm39) N214Y probably damaging Het
Ints8 A G 4: 11,208,824 (GRCm39) probably null Het
Itpa T A 2: 130,517,639 (GRCm39) V129E probably damaging Het
Itpripl1 T A 2: 126,983,262 (GRCm39) M287L probably benign Het
Klc3 T C 7: 19,129,784 (GRCm39) I362V probably damaging Het
Ky T A 9: 102,402,590 (GRCm39) probably benign Het
Lasp1 A G 11: 97,697,709 (GRCm39) N43S possibly damaging Het
Limk2 A G 11: 3,300,763 (GRCm39) M380T probably benign Het
Lrp2 T A 2: 69,289,957 (GRCm39) E3627D probably damaging Het
Lrrc25 T C 8: 71,070,459 (GRCm39) L80P probably damaging Het
Mcoln3 A T 3: 145,846,276 (GRCm39) K529* probably null Het
Med12l A G 3: 59,159,751 (GRCm39) I1267V probably benign Het
Mei4 C A 9: 81,809,595 (GRCm39) S226* probably null Het
Mios G A 6: 8,234,255 (GRCm39) V809M probably benign Het
Mmp17 G A 5: 129,672,486 (GRCm39) R146Q possibly damaging Het
Mob3a G A 10: 80,527,218 (GRCm39) Q36* probably null Het
Myo3a T A 2: 22,296,607 (GRCm39) probably benign Het
Naca A T 10: 127,883,943 (GRCm39) I2125F probably damaging Het
Ndst3 A C 3: 123,322,564 (GRCm39) S840A probably benign Het
Nlrp4c T C 7: 6,068,603 (GRCm39) M168T probably damaging Het
Nt5c3 A G 6: 56,874,758 (GRCm39) probably null Het
Or1af1 T A 2: 37,109,956 (GRCm39) S152T probably damaging Het
Or4a72 C A 2: 89,405,623 (GRCm39) G149V probably damaging Het
Or5b124 T C 19: 13,611,401 (GRCm39) S309P probably benign Het
Or6c5 T A 10: 129,074,678 (GRCm39) I220N possibly damaging Het
Pcgf3 A G 5: 108,634,063 (GRCm39) D107G probably benign Het
Pde2a A G 7: 101,159,588 (GRCm39) D816G probably damaging Het
Phf10 T A 17: 15,176,261 (GRCm39) T131S possibly damaging Het
Phf11 A T 14: 59,482,262 (GRCm39) C164S probably damaging Het
Phrf1 A G 7: 140,812,446 (GRCm39) D70G unknown Het
Piezo2 A G 18: 63,226,086 (GRCm39) L850S probably damaging Het
Plcg1 T A 2: 160,596,473 (GRCm39) probably benign Het
Plekhh2 A T 17: 84,882,421 (GRCm39) I676L probably benign Het
Ppp1r9a T G 6: 5,115,196 (GRCm39) V804G probably damaging Het
Ppt2 T C 17: 34,844,613 (GRCm39) H180R possibly damaging Het
Prdm15 T C 16: 97,618,066 (GRCm39) H398R unknown Het
Rab26 A T 17: 24,748,772 (GRCm39) M208K probably damaging Het
Rab31 A C 17: 65,974,859 (GRCm39) probably benign Het
Radil A G 5: 142,471,204 (GRCm39) V1024A probably damaging Het
Rorb A G 19: 18,960,780 (GRCm39) I65T probably damaging Het
Sall1 A T 8: 89,759,483 (GRCm39) V207E probably damaging Het
Sart3 A T 5: 113,882,728 (GRCm39) M864K possibly damaging Het
Sdcbp2 T A 2: 151,431,457 (GRCm39) S277T probably benign Het
Septin5 A G 16: 18,443,622 (GRCm39) V100A probably benign Het
Sipa1 C T 19: 5,710,980 (GRCm39) R10Q probably damaging Het
Ski A T 4: 155,245,119 (GRCm39) S376T probably damaging Het
Slc15a4 A T 5: 127,673,715 (GRCm39) D566E probably benign Het
Srgap2 G A 1: 131,273,544 (GRCm39) Q372* probably null Het
Stard9 A G 2: 120,534,059 (GRCm39) T3439A probably damaging Het
Tln1 T C 4: 43,534,769 (GRCm39) probably benign Het
Tmco3 A G 8: 13,345,998 (GRCm39) M279V probably benign Het
Tmem39b T C 4: 129,570,191 (GRCm39) probably benign Het
Trio T A 15: 27,732,632 (GRCm39) N3083I probably damaging Het
Ube3b G A 5: 114,531,151 (GRCm39) R215Q probably benign Het
Ubr1 T C 2: 120,696,964 (GRCm39) N1646S probably benign Het
Uqcrc1 T G 9: 108,776,108 (GRCm39) F270C probably damaging Het
Vmn2r108 T A 17: 20,682,687 (GRCm39) N839I probably damaging Het
Vmn2r75 A T 7: 85,812,476 (GRCm39) S514R probably damaging Het
Wdfy4 C G 14: 32,689,489 (GRCm39) V3016L Het
Wdr11 A G 7: 129,200,780 (GRCm39) N77S probably benign Het
Wdr17 C A 8: 55,093,127 (GRCm39) probably benign Het
Wrn T A 8: 33,782,671 (GRCm39) N753I probably damaging Het
Zan A G 5: 137,461,539 (GRCm39) probably null Het
Zfat T A 15: 67,956,278 (GRCm39) T1203S possibly damaging Het
Zfhx2 A C 14: 55,312,509 (GRCm39) S62A probably benign Het
Other mutations in Mdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Mdn1 APN 4 32,723,651 (GRCm39) missense probably damaging 1.00
IGL00426:Mdn1 APN 4 32,719,214 (GRCm39) missense possibly damaging 0.91
IGL00570:Mdn1 APN 4 32,735,719 (GRCm39) missense probably benign
IGL00573:Mdn1 APN 4 32,666,619 (GRCm39) critical splice donor site probably null
IGL00983:Mdn1 APN 4 32,735,525 (GRCm39) missense probably damaging 1.00
IGL01288:Mdn1 APN 4 32,730,864 (GRCm39) missense probably benign 0.00
IGL01359:Mdn1 APN 4 32,743,686 (GRCm39) missense probably benign 0.10
IGL01457:Mdn1 APN 4 32,715,922 (GRCm39) missense possibly damaging 0.82
IGL01530:Mdn1 APN 4 32,711,938 (GRCm39) splice site probably benign
IGL01684:Mdn1 APN 4 32,726,857 (GRCm39) missense probably benign
IGL01753:Mdn1 APN 4 32,708,483 (GRCm39) missense probably benign
IGL01901:Mdn1 APN 4 32,669,591 (GRCm39) missense probably damaging 1.00
IGL01952:Mdn1 APN 4 32,723,657 (GRCm39) missense possibly damaging 0.82
IGL01960:Mdn1 APN 4 32,758,393 (GRCm39) missense probably benign 0.14
IGL02019:Mdn1 APN 4 32,749,948 (GRCm39) missense possibly damaging 0.93
IGL02100:Mdn1 APN 4 32,715,708 (GRCm39) missense possibly damaging 0.90
IGL02117:Mdn1 APN 4 32,709,364 (GRCm39) missense probably benign 0.00
IGL02154:Mdn1 APN 4 32,740,395 (GRCm39) missense probably benign 0.35
IGL02216:Mdn1 APN 4 32,739,092 (GRCm39) missense probably benign 0.03
IGL02371:Mdn1 APN 4 32,676,860 (GRCm39) splice site probably benign
IGL02396:Mdn1 APN 4 32,700,120 (GRCm39) missense probably damaging 0.99
IGL02454:Mdn1 APN 4 32,694,674 (GRCm39) critical splice donor site probably null
IGL02502:Mdn1 APN 4 32,670,579 (GRCm39) missense possibly damaging 0.69
IGL02883:Mdn1 APN 4 32,763,199 (GRCm39) missense probably benign 0.05
IGL02946:Mdn1 APN 4 32,734,366 (GRCm39) missense probably damaging 0.98
IGL02950:Mdn1 APN 4 32,713,360 (GRCm39) splice site probably benign
IGL03076:Mdn1 APN 4 32,735,564 (GRCm39) missense probably damaging 0.97
IGL03129:Mdn1 APN 4 32,729,994 (GRCm39) missense possibly damaging 0.47
IGL03234:Mdn1 APN 4 32,732,842 (GRCm39) missense probably benign 0.06
3-1:Mdn1 UTSW 4 32,725,967 (GRCm39) critical splice donor site probably null
IGL03046:Mdn1 UTSW 4 32,694,495 (GRCm39) missense possibly damaging 0.73
P0035:Mdn1 UTSW 4 32,749,934 (GRCm39) missense probably benign 0.05
PIT4508001:Mdn1 UTSW 4 32,719,223 (GRCm39) missense probably damaging 0.97
PIT4618001:Mdn1 UTSW 4 32,746,527 (GRCm39) missense probably benign 0.20
R0008:Mdn1 UTSW 4 32,718,317 (GRCm39) missense possibly damaging 0.47
R0110:Mdn1 UTSW 4 32,738,619 (GRCm39) missense probably benign 0.20
R0125:Mdn1 UTSW 4 32,729,956 (GRCm39) missense probably damaging 0.98
R0257:Mdn1 UTSW 4 32,693,534 (GRCm39) missense probably damaging 0.99
R0266:Mdn1 UTSW 4 32,741,835 (GRCm39) missense probably damaging 0.99
R0349:Mdn1 UTSW 4 32,750,318 (GRCm39) missense probably damaging 1.00
R0362:Mdn1 UTSW 4 32,746,439 (GRCm39) critical splice acceptor site probably null
R0421:Mdn1 UTSW 4 32,684,707 (GRCm39) missense probably benign 0.39
R0450:Mdn1 UTSW 4 32,738,619 (GRCm39) missense probably benign 0.20
R0465:Mdn1 UTSW 4 32,699,204 (GRCm39) splice site probably benign
R0469:Mdn1 UTSW 4 32,738,619 (GRCm39) missense probably benign 0.20
R0477:Mdn1 UTSW 4 32,750,928 (GRCm39) missense probably benign 0.02
R0481:Mdn1 UTSW 4 32,767,182 (GRCm39) splice site probably benign
R0504:Mdn1 UTSW 4 32,698,916 (GRCm39) splice site probably benign
R0522:Mdn1 UTSW 4 32,672,837 (GRCm39) missense probably benign 0.09
R0550:Mdn1 UTSW 4 32,730,479 (GRCm39) missense probably benign 0.13
R0607:Mdn1 UTSW 4 32,732,829 (GRCm39) missense probably benign 0.36
R0607:Mdn1 UTSW 4 32,712,014 (GRCm39) missense probably damaging 1.00
R0664:Mdn1 UTSW 4 32,768,011 (GRCm39) nonsense probably null
R0701:Mdn1 UTSW 4 32,699,263 (GRCm39) missense probably benign 0.00
R0801:Mdn1 UTSW 4 32,668,895 (GRCm39) missense probably benign 0.04
R0841:Mdn1 UTSW 4 32,752,032 (GRCm39) missense probably benign 0.23
R0849:Mdn1 UTSW 4 32,741,835 (GRCm39) missense probably damaging 0.99
R0893:Mdn1 UTSW 4 32,701,713 (GRCm39) missense probably benign 0.01
R1114:Mdn1 UTSW 4 32,746,568 (GRCm39) critical splice donor site probably null
R1137:Mdn1 UTSW 4 32,694,511 (GRCm39) missense probably damaging 1.00
R1185:Mdn1 UTSW 4 32,735,576 (GRCm39) missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32,735,576 (GRCm39) missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32,735,576 (GRCm39) missense possibly damaging 0.94
R1257:Mdn1 UTSW 4 32,667,089 (GRCm39) critical splice acceptor site probably null
R1356:Mdn1 UTSW 4 32,700,334 (GRCm39) splice site probably benign
R1466:Mdn1 UTSW 4 32,730,788 (GRCm39) missense probably benign 0.28
R1466:Mdn1 UTSW 4 32,730,788 (GRCm39) missense probably benign 0.28
R1518:Mdn1 UTSW 4 32,739,977 (GRCm39) missense probably damaging 1.00
R1569:Mdn1 UTSW 4 32,723,501 (GRCm39) missense probably null 0.10
R1574:Mdn1 UTSW 4 32,722,315 (GRCm39) missense probably benign
R1574:Mdn1 UTSW 4 32,722,315 (GRCm39) missense probably benign
R1591:Mdn1 UTSW 4 32,700,092 (GRCm39) missense possibly damaging 0.65
R1678:Mdn1 UTSW 4 32,663,050 (GRCm39) missense probably damaging 0.99
R1696:Mdn1 UTSW 4 32,700,417 (GRCm39) missense possibly damaging 0.91
R1707:Mdn1 UTSW 4 32,693,504 (GRCm39) missense probably damaging 1.00
R1749:Mdn1 UTSW 4 32,773,952 (GRCm39) missense probably damaging 1.00
R1780:Mdn1 UTSW 4 32,700,103 (GRCm39) missense probably damaging 1.00
R1833:Mdn1 UTSW 4 32,720,761 (GRCm39) missense probably damaging 0.97
R1858:Mdn1 UTSW 4 32,730,881 (GRCm39) missense probably benign 0.17
R1870:Mdn1 UTSW 4 32,763,339 (GRCm39) missense probably damaging 1.00
R1887:Mdn1 UTSW 4 32,742,540 (GRCm39) missense probably damaging 1.00
R1909:Mdn1 UTSW 4 32,760,839 (GRCm39) small deletion probably benign
R2075:Mdn1 UTSW 4 32,716,058 (GRCm39) missense probably benign 0.03
R2103:Mdn1 UTSW 4 32,738,712 (GRCm39) missense possibly damaging 0.75
R2104:Mdn1 UTSW 4 32,743,843 (GRCm39) splice site probably null
R2110:Mdn1 UTSW 4 32,700,409 (GRCm39) missense probably damaging 1.00
R2111:Mdn1 UTSW 4 32,700,409 (GRCm39) missense probably damaging 1.00
R2206:Mdn1 UTSW 4 32,716,271 (GRCm39) missense possibly damaging 0.71
R2221:Mdn1 UTSW 4 32,763,306 (GRCm39) missense probably benign 0.37
R2240:Mdn1 UTSW 4 32,765,701 (GRCm39) missense possibly damaging 0.90
R2351:Mdn1 UTSW 4 32,750,010 (GRCm39) missense probably benign 0.21
R2421:Mdn1 UTSW 4 32,723,621 (GRCm39) missense probably damaging 0.96
R3036:Mdn1 UTSW 4 32,750,013 (GRCm39) missense probably damaging 0.99
R3434:Mdn1 UTSW 4 32,733,726 (GRCm39) critical splice donor site probably null
R3435:Mdn1 UTSW 4 32,733,726 (GRCm39) critical splice donor site probably null
R3783:Mdn1 UTSW 4 32,720,818 (GRCm39) missense probably benign 0.01
R3811:Mdn1 UTSW 4 32,693,506 (GRCm39) nonsense probably null
R3973:Mdn1 UTSW 4 32,722,363 (GRCm39) missense probably benign 0.00
R4154:Mdn1 UTSW 4 32,707,475 (GRCm39) missense probably damaging 0.96
R4372:Mdn1 UTSW 4 32,743,809 (GRCm39) missense probably benign 0.03
R4393:Mdn1 UTSW 4 32,754,482 (GRCm39) missense possibly damaging 0.48
R4438:Mdn1 UTSW 4 32,704,635 (GRCm39) missense probably damaging 1.00
R4471:Mdn1 UTSW 4 32,668,860 (GRCm39) missense probably benign 0.00
R4509:Mdn1 UTSW 4 32,715,883 (GRCm39) missense probably damaging 1.00
R4538:Mdn1 UTSW 4 32,722,334 (GRCm39) missense probably damaging 1.00
R4557:Mdn1 UTSW 4 32,754,437 (GRCm39) missense probably damaging 1.00
R4570:Mdn1 UTSW 4 32,741,812 (GRCm39) missense probably damaging 1.00
R4591:Mdn1 UTSW 4 32,707,636 (GRCm39) missense probably damaging 1.00
R4658:Mdn1 UTSW 4 32,730,749 (GRCm39) splice site probably null
R4667:Mdn1 UTSW 4 32,679,572 (GRCm39) missense probably damaging 1.00
R4684:Mdn1 UTSW 4 32,666,430 (GRCm39) missense probably damaging 1.00
R4778:Mdn1 UTSW 4 32,683,583 (GRCm39) nonsense probably null
R4807:Mdn1 UTSW 4 32,685,651 (GRCm39) splice site probably null
R4923:Mdn1 UTSW 4 32,671,608 (GRCm39) missense possibly damaging 0.89
R4951:Mdn1 UTSW 4 32,707,459 (GRCm39) missense probably damaging 1.00
R4963:Mdn1 UTSW 4 32,756,512 (GRCm39) missense probably benign 0.00
R4971:Mdn1 UTSW 4 32,739,827 (GRCm39) missense probably damaging 1.00
R4973:Mdn1 UTSW 4 32,734,418 (GRCm39) missense probably benign 0.01
R5122:Mdn1 UTSW 4 32,670,593 (GRCm39) missense probably damaging 1.00
R5159:Mdn1 UTSW 4 32,774,008 (GRCm39) missense possibly damaging 0.93
R5164:Mdn1 UTSW 4 32,759,011 (GRCm39) splice site probably null
R5215:Mdn1 UTSW 4 32,741,418 (GRCm39) missense possibly damaging 0.78
R5217:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5219:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5365:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5366:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5368:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5445:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5462:Mdn1 UTSW 4 32,720,897 (GRCm39) missense probably benign
R5522:Mdn1 UTSW 4 32,685,783 (GRCm39) missense probably damaging 1.00
R5525:Mdn1 UTSW 4 32,767,961 (GRCm39) missense possibly damaging 0.73
R5578:Mdn1 UTSW 4 32,728,167 (GRCm39) missense probably benign 0.04
R5605:Mdn1 UTSW 4 32,765,664 (GRCm39) missense probably benign
R5621:Mdn1 UTSW 4 32,716,371 (GRCm39) missense possibly damaging 0.46
R5636:Mdn1 UTSW 4 32,695,480 (GRCm39) missense probably damaging 1.00
R5650:Mdn1 UTSW 4 32,667,467 (GRCm39) splice site probably null
R5780:Mdn1 UTSW 4 32,722,950 (GRCm39) missense probably benign 0.02
R5838:Mdn1 UTSW 4 32,754,547 (GRCm39) missense probably damaging 0.99
R5857:Mdn1 UTSW 4 32,670,646 (GRCm39) missense probably benign 0.09
R5895:Mdn1 UTSW 4 32,695,400 (GRCm39) missense probably damaging 1.00
R5943:Mdn1 UTSW 4 32,678,330 (GRCm39) missense probably damaging 1.00
R6008:Mdn1 UTSW 4 32,741,073 (GRCm39) missense probably damaging 1.00
R6013:Mdn1 UTSW 4 32,715,713 (GRCm39) missense probably damaging 1.00
R6075:Mdn1 UTSW 4 32,689,581 (GRCm39) missense possibly damaging 0.48
R6151:Mdn1 UTSW 4 32,684,735 (GRCm39) missense probably damaging 1.00
R6163:Mdn1 UTSW 4 32,716,040 (GRCm39) missense probably damaging 1.00
R6181:Mdn1 UTSW 4 32,715,953 (GRCm39) missense probably damaging 1.00
R6211:Mdn1 UTSW 4 32,696,269 (GRCm39) missense probably benign 0.12
R6249:Mdn1 UTSW 4 32,708,484 (GRCm39) missense possibly damaging 0.85
R6251:Mdn1 UTSW 4 32,748,590 (GRCm39) missense probably benign 0.13
R6253:Mdn1 UTSW 4 32,749,593 (GRCm39) missense probably benign 0.25
R6273:Mdn1 UTSW 4 32,715,979 (GRCm39) missense probably benign 0.01
R6297:Mdn1 UTSW 4 32,730,054 (GRCm39) nonsense probably null
R6384:Mdn1 UTSW 4 32,670,607 (GRCm39) missense probably damaging 1.00
R6463:Mdn1 UTSW 4 32,773,308 (GRCm39) missense probably damaging 1.00
R6528:Mdn1 UTSW 4 32,713,780 (GRCm39) missense probably damaging 1.00
R6688:Mdn1 UTSW 4 32,774,041 (GRCm39) missense possibly damaging 0.74
R6762:Mdn1 UTSW 4 32,676,786 (GRCm39) missense possibly damaging 0.50
R6794:Mdn1 UTSW 4 32,741,893 (GRCm39) missense probably damaging 1.00
R6894:Mdn1 UTSW 4 32,748,614 (GRCm39) missense possibly damaging 0.75
R6935:Mdn1 UTSW 4 32,774,041 (GRCm39) missense possibly damaging 0.74
R6980:Mdn1 UTSW 4 32,726,942 (GRCm39) critical splice donor site probably null
R6995:Mdn1 UTSW 4 32,733,374 (GRCm39) missense probably benign 0.03
R7048:Mdn1 UTSW 4 32,767,969 (GRCm39) missense probably benign 0.00
R7082:Mdn1 UTSW 4 32,762,341 (GRCm39) missense probably benign
R7158:Mdn1 UTSW 4 32,725,121 (GRCm39) missense probably benign 0.09
R7166:Mdn1 UTSW 4 32,746,446 (GRCm39) missense probably damaging 1.00
R7168:Mdn1 UTSW 4 32,719,184 (GRCm39) missense probably damaging 1.00
R7175:Mdn1 UTSW 4 32,694,634 (GRCm39) missense probably damaging 1.00
R7195:Mdn1 UTSW 4 32,701,823 (GRCm39) missense probably damaging 1.00
R7250:Mdn1 UTSW 4 32,695,427 (GRCm39) missense probably damaging 1.00
R7274:Mdn1 UTSW 4 32,725,944 (GRCm39) missense probably benign 0.12
R7330:Mdn1 UTSW 4 32,723,685 (GRCm39) missense probably benign 0.16
R7363:Mdn1 UTSW 4 32,691,729 (GRCm39) missense probably damaging 0.99
R7369:Mdn1 UTSW 4 32,773,375 (GRCm39) missense probably damaging 0.99
R7452:Mdn1 UTSW 4 32,739,030 (GRCm39) missense possibly damaging 0.87
R7523:Mdn1 UTSW 4 32,667,270 (GRCm39) critical splice acceptor site probably null
R7594:Mdn1 UTSW 4 32,696,359 (GRCm39) missense probably benign 0.27
R7605:Mdn1 UTSW 4 32,694,599 (GRCm39) missense probably damaging 1.00
R7661:Mdn1 UTSW 4 32,691,229 (GRCm39) missense probably benign 0.08
R7689:Mdn1 UTSW 4 32,739,912 (GRCm39) missense probably damaging 1.00
R7699:Mdn1 UTSW 4 32,741,344 (GRCm39) missense probably damaging 1.00
R7700:Mdn1 UTSW 4 32,741,344 (GRCm39) missense probably damaging 1.00
R7714:Mdn1 UTSW 4 32,722,360 (GRCm39) missense possibly damaging 0.75
R7718:Mdn1 UTSW 4 32,718,420 (GRCm39) missense probably damaging 1.00
R7762:Mdn1 UTSW 4 32,734,421 (GRCm39) missense probably benign
R7787:Mdn1 UTSW 4 32,741,794 (GRCm39) missense probably damaging 1.00
R8111:Mdn1 UTSW 4 32,674,003 (GRCm39) missense possibly damaging 0.81
R8222:Mdn1 UTSW 4 32,707,477 (GRCm39) missense probably benign 0.09
R8246:Mdn1 UTSW 4 32,657,284 (GRCm39) missense probably benign 0.06
R8267:Mdn1 UTSW 4 32,742,485 (GRCm39) missense possibly damaging 0.82
R8286:Mdn1 UTSW 4 32,731,960 (GRCm39) missense possibly damaging 0.91
R8305:Mdn1 UTSW 4 32,725,107 (GRCm39) missense probably benign
R8318:Mdn1 UTSW 4 32,735,897 (GRCm39) critical splice donor site probably null
R8379:Mdn1 UTSW 4 32,756,453 (GRCm39) missense probably null 1.00
R8384:Mdn1 UTSW 4 32,765,680 (GRCm39) missense probably benign 0.05
R8514:Mdn1 UTSW 4 32,739,857 (GRCm39) missense probably damaging 1.00
R8560:Mdn1 UTSW 4 32,743,830 (GRCm39) missense probably benign 0.08
R8672:Mdn1 UTSW 4 32,768,793 (GRCm39) missense probably damaging 1.00
R8769:Mdn1 UTSW 4 32,751,390 (GRCm39) missense probably damaging 0.97
R8896:Mdn1 UTSW 4 32,678,328 (GRCm39) missense probably benign 0.28
R8918:Mdn1 UTSW 4 32,744,579 (GRCm39) nonsense probably null
R8920:Mdn1 UTSW 4 32,719,280 (GRCm39) missense probably damaging 1.00
R8966:Mdn1 UTSW 4 32,672,837 (GRCm39) nonsense probably null
R8997:Mdn1 UTSW 4 32,773,275 (GRCm39) missense probably damaging 1.00
R9120:Mdn1 UTSW 4 32,701,814 (GRCm39) missense probably damaging 1.00
R9129:Mdn1 UTSW 4 32,676,812 (GRCm39) missense probably benign 0.24
R9131:Mdn1 UTSW 4 32,762,275 (GRCm39) missense possibly damaging 0.69
R9200:Mdn1 UTSW 4 32,760,791 (GRCm39) missense probably benign 0.00
R9226:Mdn1 UTSW 4 32,694,612 (GRCm39) missense probably benign 0.25
R9235:Mdn1 UTSW 4 32,739,122 (GRCm39) missense probably benign 0.10
R9293:Mdn1 UTSW 4 32,707,579 (GRCm39) missense probably damaging 1.00
R9315:Mdn1 UTSW 4 32,760,911 (GRCm39) missense probably benign 0.00
R9338:Mdn1 UTSW 4 32,666,536 (GRCm39) missense probably benign 0.00
R9353:Mdn1 UTSW 4 32,693,504 (GRCm39) missense probably damaging 1.00
R9393:Mdn1 UTSW 4 32,713,825 (GRCm39) missense
R9420:Mdn1 UTSW 4 32,678,414 (GRCm39) missense probably damaging 1.00
R9475:Mdn1 UTSW 4 32,739,849 (GRCm39) missense possibly damaging 0.65
R9583:Mdn1 UTSW 4 32,741,372 (GRCm39) missense probably damaging 1.00
R9600:Mdn1 UTSW 4 32,684,723 (GRCm39) nonsense probably null
R9640:Mdn1 UTSW 4 32,754,539 (GRCm39) missense probably damaging 1.00
R9688:Mdn1 UTSW 4 32,745,590 (GRCm39) missense probably damaging 1.00
R9744:Mdn1 UTSW 4 32,715,711 (GRCm39) missense possibly damaging 0.91
X0066:Mdn1 UTSW 4 32,739,030 (GRCm39) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,696,244 (GRCm39) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,668,944 (GRCm39) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,667,102 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGAAGAGTTAGCCTTTGGTGTTTC -3'
(R):5'- CACTAATGCTGAGTGAATATGATGACC -3'

Sequencing Primer
(F):5'- AGCCTTTGGTGTTTCTTCTTTTGAC -3'
(R):5'- TGGTTAAAGCCCATGTGACC -3'
Posted On 2021-04-30