Incidental Mutation 'R8708:Fryl'
ID 669347
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene Name FRY like transcription coactivator
Synonyms 2510002A14Rik, 2310004H21Rik, 9030227G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.675) question?
Stock # R8708 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 73019987-73256619 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73132562 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 107 (E107G)
Ref Sequence ENSEMBL: ENSMUSP00000092289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094700
AA Change: E107G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: E107G

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101127
AA Change: E107G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: E107G

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (99/101)
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,561,480 K230R probably damaging Het
Akp3 T A 1: 87,126,369 Y236* probably null Het
Alg11 T C 8: 22,065,113 F130S probably damaging Het
Ankfn1 A T 11: 89,503,930 S276R possibly damaging Het
Ankhd1 T A 18: 36,594,291 H486Q probably damaging Het
Ankrd23 T C 1: 36,534,088 T68A probably benign Het
Arhgap23 A G 11: 97,452,412 T507A probably benign Het
Arid1a A T 4: 133,681,834 D1787E unknown Het
Atad2b T A 12: 4,961,253 D504E probably damaging Het
Atg2b T A 12: 105,669,428 probably benign Het
Bptf C A 11: 107,073,313 S1685I probably damaging Het
Bptf T A 11: 107,073,314 S1685C probably damaging Het
Cacna1c A T 6: 118,627,455 I1437N Het
Capn1 T C 19: 6,011,298 K197E probably damaging Het
Ccdc177 T C 12: 80,759,117 T128A probably benign Het
Ccdc7b G T 8: 129,136,614 M9I probably benign Het
Celf1 T A 2: 91,010,580 probably null Het
Ckap5 T A 2: 91,595,478 N1285K probably benign Het
Col24a1 C T 3: 145,545,265 T1673I probably damaging Het
Dbp A G 7: 45,709,801 E300G probably damaging Het
Dchs2 C A 3: 83,128,742 H265Q probably benign Het
Dicer1 A T 12: 104,728,445 S198T possibly damaging Het
Dnase1l2 A T 17: 24,442,292 F86L probably benign Het
Dnhd1 T G 7: 105,694,280 Y1610* probably null Het
Dock5 A G 14: 67,767,371 V1529A probably benign Het
Egfr G T 11: 16,867,300 probably benign Het
Exph5 T A 9: 53,375,796 H1392Q probably benign Het
Fam78b A G 1: 167,078,763 K164E possibly damaging Het
Fignl2 C A 15: 101,052,853 R516L unknown Het
Fndc7 C T 3: 108,867,212 E577K probably benign Het
Gbp10 A T 5: 105,220,965 M336K probably damaging Het
Gm11444 A T 11: 85,846,897 C156S Het
Gm6904 A T 14: 59,244,813 C164S probably damaging Het
Gm996 C A 2: 25,577,802 R699L possibly damaging Het
Golga3 C A 5: 110,202,855 A752E probably benign Het
Gper1 G T 5: 139,425,935 V12L probably benign Het
Hmbox1 G T 14: 64,823,640 A394E probably damaging Het
Ighv1-71 T A 12: 115,742,335 I77L probably benign Het
Ing4 A T 6: 125,047,932 N214Y probably damaging Het
Ints8 A G 4: 11,208,824 probably null Het
Itpa T A 2: 130,675,719 V129E probably damaging Het
Itpripl1 T A 2: 127,141,342 M287L probably benign Het
Klc3 T C 7: 19,395,859 I362V probably damaging Het
Ky T A 9: 102,525,391 probably benign Het
Lasp1 A G 11: 97,806,883 N43S possibly damaging Het
Limk2 A G 11: 3,350,763 M380T probably benign Het
Lrp2 T A 2: 69,459,613 E3627D probably damaging Het
Lrrc25 T C 8: 70,617,809 L80P probably damaging Het
Mcoln3 A T 3: 146,140,521 K529* probably null Het
Mdn1 A C 4: 32,725,854 D2591A probably damaging Het
Med12l A G 3: 59,252,330 I1267V probably benign Het
Mei4 C A 9: 81,927,542 S226* probably null Het
Mios G A 6: 8,234,255 V809M probably benign Het
Mmp17 G A 5: 129,595,422 R146Q possibly damaging Het
Mob3a G A 10: 80,691,384 Q36* probably null Het
Myo3a T A 2: 22,291,796 probably benign Het
Naca A T 10: 128,048,074 I2125F probably damaging Het
Ndst3 A C 3: 123,528,915 S840A probably benign Het
Nlrp4c T C 7: 6,065,604 M168T probably damaging Het
Nt5c3 A G 6: 56,897,773 probably null Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr1489 T C 19: 13,634,037 S309P probably benign Het
Olfr366 T A 2: 37,219,944 S152T probably damaging Het
Olfr774 T A 10: 129,238,809 I220N possibly damaging Het
Pcgf3 A G 5: 108,486,197 D107G probably benign Het
Pde2a A G 7: 101,510,381 D816G probably damaging Het
Phf10 T A 17: 14,955,999 T131S possibly damaging Het
Phrf1 A G 7: 141,232,533 D70G unknown Het
Piezo2 A G 18: 63,093,015 L850S probably damaging Het
Plcg1 T A 2: 160,754,553 probably benign Het
Plekhh2 A T 17: 84,574,993 I676L probably benign Het
Ppp1r9a T G 6: 5,115,196 V804G probably damaging Het
Ppt2 T C 17: 34,625,639 H180R possibly damaging Het
Prdm15 T C 16: 97,816,866 H398R unknown Het
Rab26 A T 17: 24,529,798 M208K probably damaging Het
Rab31 A C 17: 65,667,864 probably benign Het
Radil A G 5: 142,485,449 V1024A probably damaging Het
Rorb A G 19: 18,983,416 I65T probably damaging Het
Sall1 A T 8: 89,032,855 V207E probably damaging Het
Sart3 A T 5: 113,744,667 M864K possibly damaging Het
Sdcbp2 T A 2: 151,589,537 S277T probably benign Het
Sept5 A G 16: 18,624,872 V100A probably benign Het
Sipa1 C T 19: 5,660,952 R10Q probably damaging Het
Ski A T 4: 155,160,662 S376T probably damaging Het
Slc15a4 A T 5: 127,596,651 D566E probably benign Het
Srgap2 G A 1: 131,345,806 Q372* probably null Het
Stard9 A G 2: 120,703,578 T3439A probably damaging Het
Tln1 T C 4: 43,534,769 probably benign Het
Tmco3 A G 8: 13,295,998 M279V probably benign Het
Tmem39b T C 4: 129,676,398 probably benign Het
Trio T A 15: 27,732,546 N3083I probably damaging Het
Ube3b G A 5: 114,393,090 R215Q probably benign Het
Ubr1 T C 2: 120,866,483 N1646S probably benign Het
Uqcrc1 T G 9: 108,947,040 F270C probably damaging Het
Vmn2r108 T A 17: 20,462,425 N839I probably damaging Het
Vmn2r75 A T 7: 86,163,268 S514R probably damaging Het
Wdfy4 C G 14: 32,967,532 V3016L Het
Wdr11 A G 7: 129,599,056 N77S probably benign Het
Wdr17 C A 8: 54,640,092 probably benign Het
Wrn T A 8: 33,292,643 N753I probably damaging Het
Zan A G 5: 137,463,277 probably null Het
Zfat T A 15: 68,084,429 T1203S possibly damaging Het
Zfhx2 A C 14: 55,075,052 S62A probably benign Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73148108 missense possibly damaging 0.92
IGL01518:Fryl APN 5 73086962 missense possibly damaging 0.76
IGL01545:Fryl APN 5 73054597 missense probably damaging 1.00
IGL01646:Fryl APN 5 73022501 critical splice donor site probably null
IGL01938:Fryl APN 5 73122364 missense probably damaging 0.98
IGL01962:Fryl APN 5 73032791 missense possibly damaging 0.62
IGL02064:Fryl APN 5 73124769 unclassified probably benign
IGL02148:Fryl APN 5 73075959 missense probably benign 0.35
IGL02418:Fryl APN 5 73110176 splice site probably benign
IGL02431:Fryl APN 5 73098308 missense probably benign 0.02
IGL02513:Fryl APN 5 73065293 missense probably damaging 1.00
IGL02557:Fryl APN 5 73098393 missense probably damaging 1.00
IGL02625:Fryl APN 5 73069877 intron probably benign
IGL02642:Fryl APN 5 73095466 missense probably benign
IGL02657:Fryl APN 5 73054860 missense probably benign 0.01
IGL02706:Fryl APN 5 73093163 missense probably benign 0.45
IGL03022:Fryl APN 5 73059383 missense possibly damaging 0.82
IGL03144:Fryl APN 5 73101455 missense probably null 0.22
IGL03155:Fryl APN 5 73076695 missense probably benign
IGL03183:Fryl APN 5 73076695 missense probably benign
IGL03275:Fryl APN 5 73148033 missense possibly damaging 0.47
IGL03310:Fryl APN 5 73136316 splice site probably benign
IGL03341:Fryl APN 5 73076695 missense probably benign
IGL03343:Fryl APN 5 73076695 missense probably benign
IGL03350:Fryl APN 5 73133306 missense probably damaging 0.99
IGL03357:Fryl APN 5 73054059 missense probably damaging 1.00
IGL03374:Fryl APN 5 73110281 splice site probably benign
IGL03375:Fryl APN 5 73088449 missense possibly damaging 0.91
bedeviled UTSW 5 73059500 missense probably damaging 1.00
Besotted UTSW 5 73072912 missense probably damaging 1.00
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0308:Fryl UTSW 5 73041604 splice site probably benign
R0312:Fryl UTSW 5 73072888 missense probably damaging 1.00
R0415:Fryl UTSW 5 73098414 missense probably damaging 0.99
R0440:Fryl UTSW 5 73086972 missense possibly damaging 0.91
R0446:Fryl UTSW 5 73097417 missense possibly damaging 0.91
R0566:Fryl UTSW 5 73064497 splice site probably benign
R0567:Fryl UTSW 5 73065391 missense possibly damaging 0.50
R0606:Fryl UTSW 5 73124734 missense probably benign 0.15
R0619:Fryl UTSW 5 73068731 missense probably benign 0.22
R0654:Fryl UTSW 5 73083372 missense probably benign 0.17
R0658:Fryl UTSW 5 73065359 missense probably damaging 1.00
R0707:Fryl UTSW 5 73083372 missense probably benign 0.17
R0744:Fryl UTSW 5 73089081 unclassified probably benign
R0745:Fryl UTSW 5 73071126 missense probably damaging 0.96
R0833:Fryl UTSW 5 73089081 unclassified probably benign
R0885:Fryl UTSW 5 73089196 missense probably damaging 0.97
R0894:Fryl UTSW 5 73041332 splice site probably benign
R1076:Fryl UTSW 5 73124673 unclassified probably benign
R1241:Fryl UTSW 5 73064925 splice site probably benign
R1241:Fryl UTSW 5 73110271 missense probably damaging 1.00
R1394:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1395:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1608:Fryl UTSW 5 73074751 nonsense probably null
R1664:Fryl UTSW 5 73059435 missense probably damaging 1.00
R1745:Fryl UTSW 5 73032861 splice site probably benign
R1937:Fryl UTSW 5 73133367 missense probably damaging 1.00
R1969:Fryl UTSW 5 73098266 missense probably benign 0.18
R1993:Fryl UTSW 5 73108493 missense probably damaging 1.00
R1994:Fryl UTSW 5 73108493 missense probably damaging 1.00
R2029:Fryl UTSW 5 73022122 nonsense probably null
R2036:Fryl UTSW 5 73022544 missense probably benign
R2036:Fryl UTSW 5 73107962 critical splice donor site probably null
R2088:Fryl UTSW 5 73065461 missense probably benign 0.02
R2105:Fryl UTSW 5 73122299 missense probably benign
R2106:Fryl UTSW 5 73098331 missense probably damaging 1.00
R2186:Fryl UTSW 5 73064975 missense probably damaging 1.00
R2239:Fryl UTSW 5 73108547 missense probably damaging 0.99
R2256:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2257:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2280:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2281:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2911:Fryl UTSW 5 73050456 missense probably damaging 0.99
R3019:Fryl UTSW 5 73082850 missense probably benign 0.01
R3416:Fryl UTSW 5 73108074 missense possibly damaging 0.84
R3783:Fryl UTSW 5 73101476 missense probably benign
R3787:Fryl UTSW 5 73101476 missense probably benign
R3837:Fryl UTSW 5 73071265 missense probably benign 0.03
R3969:Fryl UTSW 5 73112423 missense probably damaging 0.97
R4387:Fryl UTSW 5 73086560 missense possibly damaging 0.91
R4502:Fryl UTSW 5 73088397 missense probably damaging 1.00
R4658:Fryl UTSW 5 73081053 missense probably damaging 1.00
R4664:Fryl UTSW 5 73090679 missense possibly damaging 0.80
R4690:Fryl UTSW 5 73100293 missense probably benign
R4700:Fryl UTSW 5 73065538 missense possibly damaging 0.88
R4709:Fryl UTSW 5 73080972 missense probably benign 0.03
R4807:Fryl UTSW 5 73041362 missense probably benign 0.00
R4912:Fryl UTSW 5 73068782 frame shift probably null
R4948:Fryl UTSW 5 73089130 missense probably benign 0.08
R4959:Fryl UTSW 5 73035058 missense probably benign 0.00
R5062:Fryl UTSW 5 73075893 missense possibly damaging 0.89
R5067:Fryl UTSW 5 73057755 missense probably benign 0.13
R5071:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5072:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5073:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5074:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5139:Fryl UTSW 5 73090718 missense probably damaging 1.00
R5172:Fryl UTSW 5 73101673 missense possibly damaging 0.95
R5187:Fryl UTSW 5 73086600 missense possibly damaging 0.95
R5272:Fryl UTSW 5 73065136 nonsense probably null
R5275:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5295:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5344:Fryl UTSW 5 73104774 missense probably damaging 1.00
R5355:Fryl UTSW 5 73073904 missense probably damaging 1.00
R5716:Fryl UTSW 5 73100465 missense probably benign
R5778:Fryl UTSW 5 73072778 missense probably damaging 1.00
R5810:Fryl UTSW 5 73090755 missense probably benign 0.06
R5934:Fryl UTSW 5 73090717 missense probably damaging 1.00
R5948:Fryl UTSW 5 73097372 critical splice donor site probably null
R6005:Fryl UTSW 5 73083295 missense probably damaging 1.00
R6026:Fryl UTSW 5 73099997 missense probably benign 0.04
R6045:Fryl UTSW 5 73118551 missense probably damaging 0.99
R6185:Fryl UTSW 5 73112788 missense probably benign 0.43
R6247:Fryl UTSW 5 73065481 missense probably damaging 0.98
R6294:Fryl UTSW 5 73191759 intron probably benign
R6310:Fryl UTSW 5 73191761 intron probably benign
R6429:Fryl UTSW 5 73090751 missense possibly damaging 0.84
R6568:Fryl UTSW 5 73059516 missense probably damaging 1.00
R6636:Fryl UTSW 5 73133312 missense probably benign 0.01
R6664:Fryl UTSW 5 73132481 missense probably damaging 1.00
R6732:Fryl UTSW 5 73054781 missense probably damaging 1.00
R6750:Fryl UTSW 5 73022232 missense probably damaging 1.00
R6805:Fryl UTSW 5 73065094 missense probably benign 0.03
R6823:Fryl UTSW 5 73065217 missense probably damaging 0.99
R6855:Fryl UTSW 5 73059500 missense probably damaging 1.00
R6858:Fryl UTSW 5 73065032 missense probably damaging 1.00
R6868:Fryl UTSW 5 73068803 missense probably damaging 1.00
R6898:Fryl UTSW 5 73022142 missense probably damaging 0.96
R6908:Fryl UTSW 5 73022211 missense probably damaging 1.00
R6958:Fryl UTSW 5 73073929 missense possibly damaging 0.89
R6980:Fryl UTSW 5 73050430 missense probably benign 0.06
R7036:Fryl UTSW 5 73055608 missense probably benign 0.03
R7065:Fryl UTSW 5 73090756 missense probably damaging 0.96
R7097:Fryl UTSW 5 73073908 missense probably benign 0.31
R7171:Fryl UTSW 5 73122310 missense probably damaging 0.97
R7191:Fryl UTSW 5 73072912 missense probably damaging 1.00
R7207:Fryl UTSW 5 73065095 missense probably benign
R7236:Fryl UTSW 5 73108478 missense possibly damaging 0.66
R7334:Fryl UTSW 5 73047496 splice site probably null
R7425:Fryl UTSW 5 73104748 missense probably damaging 1.00
R7452:Fryl UTSW 5 73023988 missense probably damaging 1.00
R7479:Fryl UTSW 5 73097561 missense possibly damaging 0.71
R7535:Fryl UTSW 5 73098196 missense probably benign 0.15
R7538:Fryl UTSW 5 73022676 missense probably benign 0.09
R7544:Fryl UTSW 5 73081039 missense probably benign
R7548:Fryl UTSW 5 73191762 missense unknown
R7565:Fryl UTSW 5 73033720 missense probably benign 0.18
R7572:Fryl UTSW 5 73088396 missense possibly damaging 0.91
R7582:Fryl UTSW 5 73022500 critical splice donor site probably null
R7630:Fryl UTSW 5 73110245 missense possibly damaging 0.62
R7774:Fryl UTSW 5 73083384 missense probably benign 0.12
R7777:Fryl UTSW 5 73071298 missense probably damaging 0.98
R7917:Fryl UTSW 5 73054532 missense probably damaging 1.00
R7920:Fryl UTSW 5 73101807 splice site probably null
R8110:Fryl UTSW 5 73133277 missense probably benign 0.10
R8120:Fryl UTSW 5 73071184 missense probably benign 0.01
R8143:Fryl UTSW 5 73050339 missense probably benign 0.00
R8207:Fryl UTSW 5 73100500 splice site probably null
R8263:Fryl UTSW 5 73081005 missense probably damaging 1.00
R8350:Fryl UTSW 5 73068730 missense probably benign
R8359:Fryl UTSW 5 73075933 missense probably benign 0.39
R8387:Fryl UTSW 5 73136320 critical splice donor site probably null
R8403:Fryl UTSW 5 73118447 makesense probably null
R8450:Fryl UTSW 5 73068730 missense probably benign
R8514:Fryl UTSW 5 73085356 missense probably benign
R8536:Fryl UTSW 5 73100353 missense probably damaging 0.99
R8703:Fryl UTSW 5 73090654 missense probably damaging 0.99
R8783:Fryl UTSW 5 73068842 missense probably benign 0.45
R9028:Fryl UTSW 5 73098266 missense probably benign 0.18
R9045:Fryl UTSW 5 73024775 missense
R9063:Fryl UTSW 5 73081003 missense possibly damaging 0.70
R9096:Fryl UTSW 5 73108577 missense probably benign 0.01
R9345:Fryl UTSW 5 73050411 missense probably benign
R9381:Fryl UTSW 5 73083294 missense probably benign 0.24
R9386:Fryl UTSW 5 73191809 missense unknown
R9401:Fryl UTSW 5 73065220 nonsense probably null
R9497:Fryl UTSW 5 73057791 missense
R9514:Fryl UTSW 5 73104772 missense probably damaging 1.00
R9570:Fryl UTSW 5 73022155 missense probably benign 0.02
Z1088:Fryl UTSW 5 73090709 missense probably damaging 0.99
Z1088:Fryl UTSW 5 73090738 missense probably damaging 1.00
Z1176:Fryl UTSW 5 73072837 missense probably benign
Z1177:Fryl UTSW 5 73041595 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGAATCTCAGGTAACGTCCTC -3'
(R):5'- TGGGATACTGAAGCAAAGTCCC -3'

Sequencing Primer
(F):5'- GTAACGTCCTCAGGGCCATAC -3'
(R):5'- TGAAGCAAAGTCCCTGTTGC -3'
Posted On 2021-04-30