Incidental Mutation 'R8708:Fryl'
ID 669347
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene Name FRY like transcription coactivator
Synonyms 9030227G01Rik, 2310004H21Rik, 2510002A14Rik
MMRRC Submission 068562-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.787) question?
Stock # R8708 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 73177534-73414042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73289905 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 107 (E107G)
Ref Sequence ENSEMBL: ENSMUSP00000092289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094700
AA Change: E107G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: E107G

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101127
AA Change: E107G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: E107G

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (99/101)
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,403,400 (GRCm39) K230R probably damaging Het
Ajm1 C A 2: 25,467,814 (GRCm39) R699L possibly damaging Het
Akp3 T A 1: 87,054,091 (GRCm39) Y236* probably null Het
Alg11 T C 8: 22,555,129 (GRCm39) F130S probably damaging Het
Ankfn1 A T 11: 89,394,756 (GRCm39) S276R possibly damaging Het
Ankhd1 T A 18: 36,727,344 (GRCm39) H486Q probably damaging Het
Ankrd23 T C 1: 36,573,169 (GRCm39) T68A probably benign Het
Arhgap23 A G 11: 97,343,238 (GRCm39) T507A probably benign Het
Arid1a A T 4: 133,409,145 (GRCm39) D1787E unknown Het
Atad2b T A 12: 5,011,253 (GRCm39) D504E probably damaging Het
Atg2b T A 12: 105,635,687 (GRCm39) probably benign Het
Bptf C A 11: 106,964,139 (GRCm39) S1685I probably damaging Het
Bptf T A 11: 106,964,140 (GRCm39) S1685C probably damaging Het
Cacna1c A T 6: 118,604,416 (GRCm39) I1437N Het
Capn1 T C 19: 6,061,328 (GRCm39) K197E probably damaging Het
Ccdc177 T C 12: 80,805,891 (GRCm39) T128A probably benign Het
Ccdc7b G T 8: 129,863,095 (GRCm39) M9I probably benign Het
Celf1 T A 2: 90,840,925 (GRCm39) probably null Het
Ckap5 T A 2: 91,425,823 (GRCm39) N1285K probably benign Het
Col24a1 C T 3: 145,251,020 (GRCm39) T1673I probably damaging Het
Dbp A G 7: 45,359,225 (GRCm39) E300G probably damaging Het
Dchs2 C A 3: 83,036,049 (GRCm39) H265Q probably benign Het
Dicer1 A T 12: 104,694,704 (GRCm39) S198T possibly damaging Het
Dnase1l2 A T 17: 24,661,266 (GRCm39) F86L probably benign Het
Dnhd1 T G 7: 105,343,487 (GRCm39) Y1610* probably null Het
Dock5 A G 14: 68,004,820 (GRCm39) V1529A probably benign Het
Egfr G T 11: 16,817,300 (GRCm39) probably benign Het
Exph5 T A 9: 53,287,096 (GRCm39) H1392Q probably benign Het
Fam78b A G 1: 166,906,332 (GRCm39) K164E possibly damaging Het
Fignl2 C A 15: 100,950,734 (GRCm39) R516L unknown Het
Fndc7 C T 3: 108,774,528 (GRCm39) E577K probably benign Het
Gbp10 A T 5: 105,368,831 (GRCm39) M336K probably damaging Het
Gm11444 A T 11: 85,737,723 (GRCm39) C156S Het
Golga3 C A 5: 110,350,721 (GRCm39) A752E probably benign Het
Gper1 G T 5: 139,411,690 (GRCm39) V12L probably benign Het
Hmbox1 G T 14: 65,061,089 (GRCm39) A394E probably damaging Het
Ighv1-71 T A 12: 115,705,955 (GRCm39) I77L probably benign Het
Ing4 A T 6: 125,024,895 (GRCm39) N214Y probably damaging Het
Ints8 A G 4: 11,208,824 (GRCm39) probably null Het
Itpa T A 2: 130,517,639 (GRCm39) V129E probably damaging Het
Itpripl1 T A 2: 126,983,262 (GRCm39) M287L probably benign Het
Klc3 T C 7: 19,129,784 (GRCm39) I362V probably damaging Het
Ky T A 9: 102,402,590 (GRCm39) probably benign Het
Lasp1 A G 11: 97,697,709 (GRCm39) N43S possibly damaging Het
Limk2 A G 11: 3,300,763 (GRCm39) M380T probably benign Het
Lrp2 T A 2: 69,289,957 (GRCm39) E3627D probably damaging Het
Lrrc25 T C 8: 71,070,459 (GRCm39) L80P probably damaging Het
Mcoln3 A T 3: 145,846,276 (GRCm39) K529* probably null Het
Mdn1 A C 4: 32,725,854 (GRCm39) D2591A probably damaging Het
Med12l A G 3: 59,159,751 (GRCm39) I1267V probably benign Het
Mei4 C A 9: 81,809,595 (GRCm39) S226* probably null Het
Mios G A 6: 8,234,255 (GRCm39) V809M probably benign Het
Mmp17 G A 5: 129,672,486 (GRCm39) R146Q possibly damaging Het
Mob3a G A 10: 80,527,218 (GRCm39) Q36* probably null Het
Myo3a T A 2: 22,296,607 (GRCm39) probably benign Het
Naca A T 10: 127,883,943 (GRCm39) I2125F probably damaging Het
Ndst3 A C 3: 123,322,564 (GRCm39) S840A probably benign Het
Nlrp4c T C 7: 6,068,603 (GRCm39) M168T probably damaging Het
Nt5c3 A G 6: 56,874,758 (GRCm39) probably null Het
Or1af1 T A 2: 37,109,956 (GRCm39) S152T probably damaging Het
Or4a72 C A 2: 89,405,623 (GRCm39) G149V probably damaging Het
Or5b124 T C 19: 13,611,401 (GRCm39) S309P probably benign Het
Or6c5 T A 10: 129,074,678 (GRCm39) I220N possibly damaging Het
Pcgf3 A G 5: 108,634,063 (GRCm39) D107G probably benign Het
Pde2a A G 7: 101,159,588 (GRCm39) D816G probably damaging Het
Phf10 T A 17: 15,176,261 (GRCm39) T131S possibly damaging Het
Phf11 A T 14: 59,482,262 (GRCm39) C164S probably damaging Het
Phrf1 A G 7: 140,812,446 (GRCm39) D70G unknown Het
Piezo2 A G 18: 63,226,086 (GRCm39) L850S probably damaging Het
Plcg1 T A 2: 160,596,473 (GRCm39) probably benign Het
Plekhh2 A T 17: 84,882,421 (GRCm39) I676L probably benign Het
Ppp1r9a T G 6: 5,115,196 (GRCm39) V804G probably damaging Het
Ppt2 T C 17: 34,844,613 (GRCm39) H180R possibly damaging Het
Prdm15 T C 16: 97,618,066 (GRCm39) H398R unknown Het
Rab26 A T 17: 24,748,772 (GRCm39) M208K probably damaging Het
Rab31 A C 17: 65,974,859 (GRCm39) probably benign Het
Radil A G 5: 142,471,204 (GRCm39) V1024A probably damaging Het
Rorb A G 19: 18,960,780 (GRCm39) I65T probably damaging Het
Sall1 A T 8: 89,759,483 (GRCm39) V207E probably damaging Het
Sart3 A T 5: 113,882,728 (GRCm39) M864K possibly damaging Het
Sdcbp2 T A 2: 151,431,457 (GRCm39) S277T probably benign Het
Septin5 A G 16: 18,443,622 (GRCm39) V100A probably benign Het
Sipa1 C T 19: 5,710,980 (GRCm39) R10Q probably damaging Het
Ski A T 4: 155,245,119 (GRCm39) S376T probably damaging Het
Slc15a4 A T 5: 127,673,715 (GRCm39) D566E probably benign Het
Srgap2 G A 1: 131,273,544 (GRCm39) Q372* probably null Het
Stard9 A G 2: 120,534,059 (GRCm39) T3439A probably damaging Het
Tln1 T C 4: 43,534,769 (GRCm39) probably benign Het
Tmco3 A G 8: 13,345,998 (GRCm39) M279V probably benign Het
Tmem39b T C 4: 129,570,191 (GRCm39) probably benign Het
Trio T A 15: 27,732,632 (GRCm39) N3083I probably damaging Het
Ube3b G A 5: 114,531,151 (GRCm39) R215Q probably benign Het
Ubr1 T C 2: 120,696,964 (GRCm39) N1646S probably benign Het
Uqcrc1 T G 9: 108,776,108 (GRCm39) F270C probably damaging Het
Vmn2r108 T A 17: 20,682,687 (GRCm39) N839I probably damaging Het
Vmn2r75 A T 7: 85,812,476 (GRCm39) S514R probably damaging Het
Wdfy4 C G 14: 32,689,489 (GRCm39) V3016L Het
Wdr11 A G 7: 129,200,780 (GRCm39) N77S probably benign Het
Wdr17 C A 8: 55,093,127 (GRCm39) probably benign Het
Wrn T A 8: 33,782,671 (GRCm39) N753I probably damaging Het
Zan A G 5: 137,461,539 (GRCm39) probably null Het
Zfat T A 15: 67,956,278 (GRCm39) T1203S possibly damaging Het
Zfhx2 A C 14: 55,312,509 (GRCm39) S62A probably benign Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73,305,451 (GRCm39) missense possibly damaging 0.92
IGL01518:Fryl APN 5 73,244,305 (GRCm39) missense possibly damaging 0.76
IGL01545:Fryl APN 5 73,211,940 (GRCm39) missense probably damaging 1.00
IGL01646:Fryl APN 5 73,179,844 (GRCm39) critical splice donor site probably null
IGL01938:Fryl APN 5 73,279,707 (GRCm39) missense probably damaging 0.98
IGL01962:Fryl APN 5 73,190,134 (GRCm39) missense possibly damaging 0.62
IGL02064:Fryl APN 5 73,282,112 (GRCm39) unclassified probably benign
IGL02148:Fryl APN 5 73,233,302 (GRCm39) missense probably benign 0.35
IGL02418:Fryl APN 5 73,267,519 (GRCm39) splice site probably benign
IGL02431:Fryl APN 5 73,255,651 (GRCm39) missense probably benign 0.02
IGL02513:Fryl APN 5 73,222,636 (GRCm39) missense probably damaging 1.00
IGL02557:Fryl APN 5 73,255,736 (GRCm39) missense probably damaging 1.00
IGL02625:Fryl APN 5 73,227,220 (GRCm39) intron probably benign
IGL02642:Fryl APN 5 73,252,809 (GRCm39) missense probably benign
IGL02657:Fryl APN 5 73,212,203 (GRCm39) missense probably benign 0.01
IGL02706:Fryl APN 5 73,250,506 (GRCm39) missense probably benign 0.45
IGL03022:Fryl APN 5 73,216,726 (GRCm39) missense possibly damaging 0.82
IGL03144:Fryl APN 5 73,258,798 (GRCm39) missense probably null 0.22
IGL03155:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03183:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03275:Fryl APN 5 73,305,376 (GRCm39) missense possibly damaging 0.47
IGL03310:Fryl APN 5 73,293,659 (GRCm39) splice site probably benign
IGL03341:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03343:Fryl APN 5 73,234,038 (GRCm39) missense probably benign
IGL03350:Fryl APN 5 73,290,649 (GRCm39) missense probably damaging 0.99
IGL03357:Fryl APN 5 73,211,402 (GRCm39) missense probably damaging 1.00
IGL03374:Fryl APN 5 73,267,624 (GRCm39) splice site probably benign
IGL03375:Fryl APN 5 73,245,792 (GRCm39) missense possibly damaging 0.91
bedeviled UTSW 5 73,216,843 (GRCm39) missense probably damaging 1.00
Besotted UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R0062:Fryl UTSW 5 73,179,621 (GRCm39) missense probably benign 0.02
R0062:Fryl UTSW 5 73,179,621 (GRCm39) missense probably benign 0.02
R0308:Fryl UTSW 5 73,198,947 (GRCm39) splice site probably benign
R0312:Fryl UTSW 5 73,230,231 (GRCm39) missense probably damaging 1.00
R0415:Fryl UTSW 5 73,255,757 (GRCm39) missense probably damaging 0.99
R0440:Fryl UTSW 5 73,244,315 (GRCm39) missense possibly damaging 0.91
R0446:Fryl UTSW 5 73,254,760 (GRCm39) missense possibly damaging 0.91
R0566:Fryl UTSW 5 73,221,840 (GRCm39) splice site probably benign
R0567:Fryl UTSW 5 73,222,734 (GRCm39) missense possibly damaging 0.50
R0606:Fryl UTSW 5 73,282,077 (GRCm39) missense probably benign 0.15
R0619:Fryl UTSW 5 73,226,074 (GRCm39) missense probably benign 0.22
R0654:Fryl UTSW 5 73,240,715 (GRCm39) missense probably benign 0.17
R0658:Fryl UTSW 5 73,222,702 (GRCm39) missense probably damaging 1.00
R0707:Fryl UTSW 5 73,240,715 (GRCm39) missense probably benign 0.17
R0744:Fryl UTSW 5 73,246,424 (GRCm39) unclassified probably benign
R0745:Fryl UTSW 5 73,228,469 (GRCm39) missense probably damaging 0.96
R0833:Fryl UTSW 5 73,246,424 (GRCm39) unclassified probably benign
R0885:Fryl UTSW 5 73,246,539 (GRCm39) missense probably damaging 0.97
R0894:Fryl UTSW 5 73,198,675 (GRCm39) splice site probably benign
R1076:Fryl UTSW 5 73,282,016 (GRCm39) unclassified probably benign
R1241:Fryl UTSW 5 73,267,614 (GRCm39) missense probably damaging 1.00
R1241:Fryl UTSW 5 73,222,268 (GRCm39) splice site probably benign
R1394:Fryl UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R1395:Fryl UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R1608:Fryl UTSW 5 73,232,094 (GRCm39) nonsense probably null
R1664:Fryl UTSW 5 73,216,778 (GRCm39) missense probably damaging 1.00
R1745:Fryl UTSW 5 73,190,204 (GRCm39) splice site probably benign
R1937:Fryl UTSW 5 73,290,710 (GRCm39) missense probably damaging 1.00
R1969:Fryl UTSW 5 73,255,609 (GRCm39) missense probably benign 0.18
R1993:Fryl UTSW 5 73,265,836 (GRCm39) missense probably damaging 1.00
R1994:Fryl UTSW 5 73,265,836 (GRCm39) missense probably damaging 1.00
R2029:Fryl UTSW 5 73,179,465 (GRCm39) nonsense probably null
R2036:Fryl UTSW 5 73,265,305 (GRCm39) critical splice donor site probably null
R2036:Fryl UTSW 5 73,179,887 (GRCm39) missense probably benign
R2088:Fryl UTSW 5 73,222,804 (GRCm39) missense probably benign 0.02
R2105:Fryl UTSW 5 73,279,642 (GRCm39) missense probably benign
R2106:Fryl UTSW 5 73,255,674 (GRCm39) missense probably damaging 1.00
R2186:Fryl UTSW 5 73,222,318 (GRCm39) missense probably damaging 1.00
R2239:Fryl UTSW 5 73,265,890 (GRCm39) missense probably damaging 0.99
R2256:Fryl UTSW 5 73,230,187 (GRCm39) missense possibly damaging 0.47
R2257:Fryl UTSW 5 73,230,187 (GRCm39) missense possibly damaging 0.47
R2280:Fryl UTSW 5 73,198,707 (GRCm39) missense possibly damaging 0.47
R2281:Fryl UTSW 5 73,198,707 (GRCm39) missense possibly damaging 0.47
R2911:Fryl UTSW 5 73,207,799 (GRCm39) missense probably damaging 0.99
R3019:Fryl UTSW 5 73,240,193 (GRCm39) missense probably benign 0.01
R3416:Fryl UTSW 5 73,265,417 (GRCm39) missense possibly damaging 0.84
R3783:Fryl UTSW 5 73,258,819 (GRCm39) missense probably benign
R3787:Fryl UTSW 5 73,258,819 (GRCm39) missense probably benign
R3837:Fryl UTSW 5 73,228,608 (GRCm39) missense probably benign 0.03
R3969:Fryl UTSW 5 73,269,766 (GRCm39) missense probably damaging 0.97
R4387:Fryl UTSW 5 73,243,903 (GRCm39) missense possibly damaging 0.91
R4502:Fryl UTSW 5 73,245,740 (GRCm39) missense probably damaging 1.00
R4658:Fryl UTSW 5 73,238,396 (GRCm39) missense probably damaging 1.00
R4664:Fryl UTSW 5 73,248,022 (GRCm39) missense possibly damaging 0.80
R4690:Fryl UTSW 5 73,257,636 (GRCm39) missense probably benign
R4700:Fryl UTSW 5 73,222,881 (GRCm39) missense possibly damaging 0.88
R4709:Fryl UTSW 5 73,238,315 (GRCm39) missense probably benign 0.03
R4807:Fryl UTSW 5 73,198,705 (GRCm39) missense probably benign 0.00
R4912:Fryl UTSW 5 73,226,125 (GRCm39) frame shift probably null
R4948:Fryl UTSW 5 73,246,473 (GRCm39) missense probably benign 0.08
R4959:Fryl UTSW 5 73,192,401 (GRCm39) missense probably benign 0.00
R5062:Fryl UTSW 5 73,233,236 (GRCm39) missense possibly damaging 0.89
R5067:Fryl UTSW 5 73,215,098 (GRCm39) missense probably benign 0.13
R5071:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5072:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5073:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5074:Fryl UTSW 5 73,232,110 (GRCm39) missense probably damaging 0.99
R5139:Fryl UTSW 5 73,248,061 (GRCm39) missense probably damaging 1.00
R5172:Fryl UTSW 5 73,259,016 (GRCm39) missense possibly damaging 0.95
R5187:Fryl UTSW 5 73,243,943 (GRCm39) missense possibly damaging 0.95
R5272:Fryl UTSW 5 73,222,479 (GRCm39) nonsense probably null
R5275:Fryl UTSW 5 73,270,134 (GRCm39) missense probably damaging 1.00
R5295:Fryl UTSW 5 73,270,134 (GRCm39) missense probably damaging 1.00
R5344:Fryl UTSW 5 73,262,117 (GRCm39) missense probably damaging 1.00
R5355:Fryl UTSW 5 73,231,247 (GRCm39) missense probably damaging 1.00
R5716:Fryl UTSW 5 73,257,808 (GRCm39) missense probably benign
R5778:Fryl UTSW 5 73,230,121 (GRCm39) missense probably damaging 1.00
R5810:Fryl UTSW 5 73,248,098 (GRCm39) missense probably benign 0.06
R5934:Fryl UTSW 5 73,248,060 (GRCm39) missense probably damaging 1.00
R5948:Fryl UTSW 5 73,254,715 (GRCm39) critical splice donor site probably null
R6005:Fryl UTSW 5 73,240,638 (GRCm39) missense probably damaging 1.00
R6026:Fryl UTSW 5 73,257,340 (GRCm39) missense probably benign 0.04
R6045:Fryl UTSW 5 73,275,894 (GRCm39) missense probably damaging 0.99
R6185:Fryl UTSW 5 73,270,131 (GRCm39) missense probably benign 0.43
R6247:Fryl UTSW 5 73,222,824 (GRCm39) missense probably damaging 0.98
R6294:Fryl UTSW 5 73,349,102 (GRCm39) intron probably benign
R6310:Fryl UTSW 5 73,349,104 (GRCm39) intron probably benign
R6429:Fryl UTSW 5 73,248,094 (GRCm39) missense possibly damaging 0.84
R6568:Fryl UTSW 5 73,216,859 (GRCm39) missense probably damaging 1.00
R6636:Fryl UTSW 5 73,290,655 (GRCm39) missense probably benign 0.01
R6664:Fryl UTSW 5 73,289,824 (GRCm39) missense probably damaging 1.00
R6732:Fryl UTSW 5 73,212,124 (GRCm39) missense probably damaging 1.00
R6750:Fryl UTSW 5 73,179,575 (GRCm39) missense probably damaging 1.00
R6805:Fryl UTSW 5 73,222,437 (GRCm39) missense probably benign 0.03
R6823:Fryl UTSW 5 73,222,560 (GRCm39) missense probably damaging 0.99
R6855:Fryl UTSW 5 73,216,843 (GRCm39) missense probably damaging 1.00
R6858:Fryl UTSW 5 73,222,375 (GRCm39) missense probably damaging 1.00
R6868:Fryl UTSW 5 73,226,146 (GRCm39) missense probably damaging 1.00
R6898:Fryl UTSW 5 73,179,485 (GRCm39) missense probably damaging 0.96
R6908:Fryl UTSW 5 73,179,554 (GRCm39) missense probably damaging 1.00
R6958:Fryl UTSW 5 73,231,272 (GRCm39) missense possibly damaging 0.89
R6980:Fryl UTSW 5 73,207,773 (GRCm39) missense probably benign 0.06
R7036:Fryl UTSW 5 73,212,951 (GRCm39) missense probably benign 0.03
R7065:Fryl UTSW 5 73,248,099 (GRCm39) missense probably damaging 0.96
R7097:Fryl UTSW 5 73,231,251 (GRCm39) missense probably benign 0.31
R7171:Fryl UTSW 5 73,279,653 (GRCm39) missense probably damaging 0.97
R7191:Fryl UTSW 5 73,230,255 (GRCm39) missense probably damaging 1.00
R7207:Fryl UTSW 5 73,222,438 (GRCm39) missense probably benign
R7236:Fryl UTSW 5 73,265,821 (GRCm39) missense possibly damaging 0.66
R7334:Fryl UTSW 5 73,204,839 (GRCm39) splice site probably null
R7425:Fryl UTSW 5 73,262,091 (GRCm39) missense probably damaging 1.00
R7452:Fryl UTSW 5 73,181,331 (GRCm39) missense probably damaging 1.00
R7479:Fryl UTSW 5 73,254,904 (GRCm39) missense possibly damaging 0.71
R7535:Fryl UTSW 5 73,255,539 (GRCm39) missense probably benign 0.15
R7538:Fryl UTSW 5 73,180,019 (GRCm39) missense probably benign 0.09
R7544:Fryl UTSW 5 73,238,382 (GRCm39) missense probably benign
R7548:Fryl UTSW 5 73,349,105 (GRCm39) missense unknown
R7565:Fryl UTSW 5 73,191,063 (GRCm39) missense probably benign 0.18
R7572:Fryl UTSW 5 73,245,739 (GRCm39) missense possibly damaging 0.91
R7582:Fryl UTSW 5 73,179,843 (GRCm39) critical splice donor site probably null
R7630:Fryl UTSW 5 73,267,588 (GRCm39) missense possibly damaging 0.62
R7774:Fryl UTSW 5 73,240,727 (GRCm39) missense probably benign 0.12
R7777:Fryl UTSW 5 73,228,641 (GRCm39) missense probably damaging 0.98
R7917:Fryl UTSW 5 73,211,875 (GRCm39) missense probably damaging 1.00
R7920:Fryl UTSW 5 73,259,150 (GRCm39) splice site probably null
R8110:Fryl UTSW 5 73,290,620 (GRCm39) missense probably benign 0.10
R8120:Fryl UTSW 5 73,228,527 (GRCm39) missense probably benign 0.01
R8143:Fryl UTSW 5 73,207,682 (GRCm39) missense probably benign 0.00
R8207:Fryl UTSW 5 73,257,843 (GRCm39) splice site probably null
R8263:Fryl UTSW 5 73,238,348 (GRCm39) missense probably damaging 1.00
R8350:Fryl UTSW 5 73,226,073 (GRCm39) missense probably benign
R8359:Fryl UTSW 5 73,233,276 (GRCm39) missense probably benign 0.39
R8387:Fryl UTSW 5 73,293,663 (GRCm39) critical splice donor site probably null
R8403:Fryl UTSW 5 73,275,790 (GRCm39) makesense probably null
R8450:Fryl UTSW 5 73,226,073 (GRCm39) missense probably benign
R8514:Fryl UTSW 5 73,242,699 (GRCm39) missense probably benign
R8536:Fryl UTSW 5 73,257,696 (GRCm39) missense probably damaging 0.99
R8703:Fryl UTSW 5 73,247,997 (GRCm39) missense probably damaging 0.99
R8783:Fryl UTSW 5 73,226,185 (GRCm39) missense probably benign 0.45
R9028:Fryl UTSW 5 73,255,609 (GRCm39) missense probably benign 0.18
R9045:Fryl UTSW 5 73,182,118 (GRCm39) missense
R9063:Fryl UTSW 5 73,238,346 (GRCm39) missense possibly damaging 0.70
R9096:Fryl UTSW 5 73,265,920 (GRCm39) missense probably benign 0.01
R9244:Fryl UTSW 5 73,348,862 (GRCm39) intron probably benign
R9345:Fryl UTSW 5 73,207,754 (GRCm39) missense probably benign
R9381:Fryl UTSW 5 73,240,637 (GRCm39) missense probably benign 0.24
R9386:Fryl UTSW 5 73,349,152 (GRCm39) missense unknown
R9401:Fryl UTSW 5 73,222,563 (GRCm39) nonsense probably null
R9497:Fryl UTSW 5 73,215,134 (GRCm39) missense
R9514:Fryl UTSW 5 73,262,115 (GRCm39) missense probably damaging 1.00
R9570:Fryl UTSW 5 73,179,498 (GRCm39) missense probably benign 0.02
R9654:Fryl UTSW 5 73,275,801 (GRCm39) missense probably benign
R9665:Fryl UTSW 5 73,222,299 (GRCm39) missense probably damaging 1.00
R9685:Fryl UTSW 5 73,216,879 (GRCm39) missense probably damaging 0.99
R9798:Fryl UTSW 5 73,192,402 (GRCm39) missense probably benign
Z1088:Fryl UTSW 5 73,248,081 (GRCm39) missense probably damaging 1.00
Z1088:Fryl UTSW 5 73,248,052 (GRCm39) missense probably damaging 0.99
Z1176:Fryl UTSW 5 73,230,180 (GRCm39) missense probably benign
Z1177:Fryl UTSW 5 73,198,938 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGAATCTCAGGTAACGTCCTC -3'
(R):5'- TGGGATACTGAAGCAAAGTCCC -3'

Sequencing Primer
(F):5'- GTAACGTCCTCAGGGCCATAC -3'
(R):5'- TGAAGCAAAGTCCCTGTTGC -3'
Posted On 2021-04-30