Incidental Mutation 'R8708:Golga3'
ID 669350
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Name golgi autoantigen, golgin subfamily a, 3
Synonyms repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8708 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 110176701-110226470 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 110202855 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 752 (A752E)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031477
AA Change: A792E

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: A792E

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112512
AA Change: A752E

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: A752E

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,561,480 K230R probably damaging Het
Akp3 T A 1: 87,126,369 Y236* probably null Het
Alg11 T C 8: 22,065,113 F130S probably damaging Het
Ankfn1 A T 11: 89,503,930 S276R possibly damaging Het
Ankhd1 T A 18: 36,594,291 H486Q probably damaging Het
Ankrd23 T C 1: 36,534,088 T68A probably benign Het
Arhgap23 A G 11: 97,452,412 T507A probably benign Het
Arid1a A T 4: 133,681,834 D1787E unknown Het
Atad2b T A 12: 4,961,253 D504E probably damaging Het
Atg2b T A 12: 105,669,428 probably benign Het
Bptf C A 11: 107,073,313 S1685I probably damaging Het
Bptf T A 11: 107,073,314 S1685C probably damaging Het
Cacna1c A T 6: 118,627,455 I1437N Het
Capn1 T C 19: 6,011,298 K197E probably damaging Het
Ccdc177 T C 12: 80,759,117 T128A probably benign Het
Ccdc7b G T 8: 129,136,614 M9I probably benign Het
Celf1 T A 2: 91,010,580 probably null Het
Ckap5 T A 2: 91,595,478 N1285K probably benign Het
Col24a1 C T 3: 145,545,265 T1673I probably damaging Het
Dbp A G 7: 45,709,801 E300G probably damaging Het
Dchs2 C A 3: 83,128,742 H265Q probably benign Het
Dicer1 A T 12: 104,728,445 S198T possibly damaging Het
Dnase1l2 A T 17: 24,442,292 F86L probably benign Het
Dnhd1 T G 7: 105,694,280 Y1610* probably null Het
Dock5 A G 14: 67,767,371 V1529A probably benign Het
Egfr G T 11: 16,867,300 probably benign Het
Exph5 T A 9: 53,375,796 H1392Q probably benign Het
Fam78b A G 1: 167,078,763 K164E possibly damaging Het
Fignl2 C A 15: 101,052,853 R516L unknown Het
Fndc7 C T 3: 108,867,212 E577K probably benign Het
Fryl T C 5: 73,132,562 E107G probably benign Het
Gbp10 A T 5: 105,220,965 M336K probably damaging Het
Gm11444 A T 11: 85,846,897 C156S Het
Gm6904 A T 14: 59,244,813 C164S probably damaging Het
Gm996 C A 2: 25,577,802 R699L possibly damaging Het
Gper1 G T 5: 139,425,935 V12L probably benign Het
Hmbox1 G T 14: 64,823,640 A394E probably damaging Het
Ighv1-71 T A 12: 115,742,335 I77L probably benign Het
Ing4 A T 6: 125,047,932 N214Y probably damaging Het
Ints8 A G 4: 11,208,824 probably null Het
Itpa T A 2: 130,675,719 V129E probably damaging Het
Itpripl1 T A 2: 127,141,342 M287L probably benign Het
Klc3 T C 7: 19,395,859 I362V probably damaging Het
Ky T A 9: 102,525,391 probably benign Het
Lasp1 A G 11: 97,806,883 N43S possibly damaging Het
Limk2 A G 11: 3,350,763 M380T probably benign Het
Lrp2 T A 2: 69,459,613 E3627D probably damaging Het
Lrrc25 T C 8: 70,617,809 L80P probably damaging Het
Mcoln3 A T 3: 146,140,521 K529* probably null Het
Mdn1 A C 4: 32,725,854 D2591A probably damaging Het
Med12l A G 3: 59,252,330 I1267V probably benign Het
Mei4 C A 9: 81,927,542 S226* probably null Het
Mios G A 6: 8,234,255 V809M probably benign Het
Mmp17 G A 5: 129,595,422 R146Q possibly damaging Het
Mob3a G A 10: 80,691,384 Q36* probably null Het
Myo3a T A 2: 22,291,796 probably benign Het
Naca A T 10: 128,048,074 I2125F probably damaging Het
Ndst3 A C 3: 123,528,915 S840A probably benign Het
Nlrp4c T C 7: 6,065,604 M168T probably damaging Het
Nt5c3 A G 6: 56,897,773 probably null Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr1489 T C 19: 13,634,037 S309P probably benign Het
Olfr366 T A 2: 37,219,944 S152T probably damaging Het
Olfr774 T A 10: 129,238,809 I220N possibly damaging Het
Pcgf3 A G 5: 108,486,197 D107G probably benign Het
Pde2a A G 7: 101,510,381 D816G probably damaging Het
Phf10 T A 17: 14,955,999 T131S possibly damaging Het
Phrf1 A G 7: 141,232,533 D70G unknown Het
Piezo2 A G 18: 63,093,015 L850S probably damaging Het
Plcg1 T A 2: 160,754,553 probably benign Het
Plekhh2 A T 17: 84,574,993 I676L probably benign Het
Ppp1r9a T G 6: 5,115,196 V804G probably damaging Het
Ppt2 T C 17: 34,625,639 H180R possibly damaging Het
Prdm15 T C 16: 97,816,866 H398R unknown Het
Rab26 A T 17: 24,529,798 M208K probably damaging Het
Rab31 A C 17: 65,667,864 probably benign Het
Radil A G 5: 142,485,449 V1024A probably damaging Het
Rorb A G 19: 18,983,416 I65T probably damaging Het
Sall1 A T 8: 89,032,855 V207E probably damaging Het
Sart3 A T 5: 113,744,667 M864K possibly damaging Het
Sdcbp2 T A 2: 151,589,537 S277T probably benign Het
Sept5 A G 16: 18,624,872 V100A probably benign Het
Sipa1 C T 19: 5,660,952 R10Q probably damaging Het
Ski A T 4: 155,160,662 S376T probably damaging Het
Slc15a4 A T 5: 127,596,651 D566E probably benign Het
Srgap2 G A 1: 131,345,806 Q372* probably null Het
Stard9 A G 2: 120,703,578 T3439A probably damaging Het
Tln1 T C 4: 43,534,769 probably benign Het
Tmco3 A G 8: 13,295,998 M279V probably benign Het
Tmem39b T C 4: 129,676,398 probably benign Het
Trio T A 15: 27,732,546 N3083I probably damaging Het
Ube3b G A 5: 114,393,090 R215Q probably benign Het
Ubr1 T C 2: 120,866,483 N1646S probably benign Het
Uqcrc1 T G 9: 108,947,040 F270C probably damaging Het
Vmn2r108 T A 17: 20,462,425 N839I probably damaging Het
Vmn2r75 A T 7: 86,163,268 S514R probably damaging Het
Wdfy4 C G 14: 32,967,532 V3016L Het
Wdr11 A G 7: 129,599,056 N77S probably benign Het
Wdr17 C A 8: 54,640,092 probably benign Het
Wrn T A 8: 33,292,643 N753I probably damaging Het
Zan A G 5: 137,463,277 probably null Het
Zfat T A 15: 68,084,429 T1203S possibly damaging Het
Zfhx2 A C 14: 55,075,052 S62A probably benign Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
cles UTSW 5 110188707 nonsense probably null
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7114:Golga3 UTSW 5 110202712 missense probably benign 0.01
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7405:Golga3 UTSW 5 110208446 missense probably damaging 0.97
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7638:Golga3 UTSW 5 110205828 missense probably benign
R7760:Golga3 UTSW 5 110205850 missense probably benign 0.39
R8099:Golga3 UTSW 5 110188707 nonsense probably null
R8144:Golga3 UTSW 5 110185879 missense probably damaging 0.99
R8558:Golga3 UTSW 5 110208555 missense possibly damaging 0.83
R8887:Golga3 UTSW 5 110205760 intron probably benign
R9039:Golga3 UTSW 5 110204933 missense probably benign 0.00
R9045:Golga3 UTSW 5 110193097 missense probably benign 0.00
R9057:Golga3 UTSW 5 110184599 missense probably damaging 1.00
R9100:Golga3 UTSW 5 110189678 missense probably benign 0.31
R9112:Golga3 UTSW 5 110185891 missense probably benign 0.08
R9198:Golga3 UTSW 5 110207753 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CTCTTGATGACCTGCATACACG -3'
(R):5'- ACAGAGAGAACCTGGTTTCCC -3'

Sequencing Primer
(F):5'- GATGACCTGCATACACGTTACGATG -3'
(R):5'- GGTGCAACAAGAACTACAGATTTC -3'
Posted On 2021-04-30