Incidental Mutation 'R8708:Klc3'
ID 669364
Institutional Source Beutler Lab
Gene Symbol Klc3
Ensembl Gene ENSMUSG00000040714
Gene Name kinesin light chain 3
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.162) question?
Stock # R8708 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 19394437-19404104 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19395859 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 362 (I362V)
Ref Sequence ENSEMBL: ENSMUSP00000038091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047170] [ENSMUST00000062831] [ENSMUST00000108457] [ENSMUST00000108458] [ENSMUST00000108459] [ENSMUST00000108460] [ENSMUST00000108461]
AlphaFold Q91W40
Predicted Effect probably damaging
Transcript: ENSMUST00000047170
AA Change: I362V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038091
Gene: ENSMUSG00000040714
AA Change: I362V

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.1e-56 PFAM
Pfam:TPR_10 206 247 1.7e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062831
SMART Domains Protein: ENSMUSP00000054380
Gene: ENSMUSG00000030400

DomainStartEndE-ValueType
DEXDc 8 280 1.62e-144 SMART
Blast:DEXDc2 340 369 3e-10 BLAST
Blast:DEXDc 412 467 9e-27 BLAST
HELICc 542 686 1.32e-76 SMART
low complexity region 733 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108457
AA Change: I362V

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104097
Gene: ENSMUSG00000040714
AA Change: I362V

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.7e-57 PFAM
Pfam:TPR_10 206 247 3.2e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108458
AA Change: I362V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104098
Gene: ENSMUSG00000040714
AA Change: I362V

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.1e-56 PFAM
Pfam:TPR_10 206 247 1.7e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108459
AA Change: I362V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104099
Gene: ENSMUSG00000040714
AA Change: I362V

DomainStartEndE-ValueType
coiled coil region 88 150 N/A INTRINSIC
low complexity region 157 173 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
Pfam:TPR_10 206 247 5.6e-7 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108460
SMART Domains Protein: ENSMUSP00000104100
Gene: ENSMUSG00000030400

DomainStartEndE-ValueType
DEXDc 8 259 1.7e-120 SMART
Blast:DEXDc2 319 348 3e-10 BLAST
Blast:DEXDc 391 446 8e-27 BLAST
HELICc 521 665 1.32e-76 SMART
low complexity region 712 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108461
SMART Domains Protein: ENSMUSP00000104101
Gene: ENSMUSG00000030400

DomainStartEndE-ValueType
Pfam:DUF1227 16 161 4.5e-60 PFAM
Blast:HELICc2 193 262 1e-40 BLAST
HELICc 290 434 1.32e-76 SMART
low complexity region 481 499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129249
SMART Domains Protein: ENSMUSP00000117840
Gene: ENSMUSG00000030400

DomainStartEndE-ValueType
DEXDc 10 204 1.14e-71 SMART
Blast:DEXDc2 264 293 2e-10 BLAST
Blast:DEXDc 336 391 5e-27 BLAST
HELICc 466 610 1.32e-76 SMART
low complexity region 657 675 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin light chain gene family. Kinesins are molecular motors involved in the transport of cargo along microtubules, and are composed of two kinesin heavy chain (KHC) and two kinesin light chain (KLC) molecules. KLCs are thought to typically be involved in binding cargo and regulating kinesin activity. In the rat, a protein similar to this gene product is expressed in post-meiotic spermatids, where it associates with structural components of sperm tails and mitochondria. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,561,480 K230R probably damaging Het
Akp3 T A 1: 87,126,369 Y236* probably null Het
Alg11 T C 8: 22,065,113 F130S probably damaging Het
Ankfn1 A T 11: 89,503,930 S276R possibly damaging Het
Ankhd1 T A 18: 36,594,291 H486Q probably damaging Het
Ankrd23 T C 1: 36,534,088 T68A probably benign Het
Arhgap23 A G 11: 97,452,412 T507A probably benign Het
Arid1a A T 4: 133,681,834 D1787E unknown Het
Atad2b T A 12: 4,961,253 D504E probably damaging Het
Atg2b T A 12: 105,669,428 probably benign Het
Bptf C A 11: 107,073,313 S1685I probably damaging Het
Bptf T A 11: 107,073,314 S1685C probably damaging Het
Cacna1c A T 6: 118,627,455 I1437N Het
Capn1 T C 19: 6,011,298 K197E probably damaging Het
Ccdc177 T C 12: 80,759,117 T128A probably benign Het
Ccdc7b G T 8: 129,136,614 M9I probably benign Het
Celf1 T A 2: 91,010,580 probably null Het
Ckap5 T A 2: 91,595,478 N1285K probably benign Het
Col24a1 C T 3: 145,545,265 T1673I probably damaging Het
Dbp A G 7: 45,709,801 E300G probably damaging Het
Dchs2 C A 3: 83,128,742 H265Q probably benign Het
Dicer1 A T 12: 104,728,445 S198T possibly damaging Het
Dnase1l2 A T 17: 24,442,292 F86L probably benign Het
Dnhd1 T G 7: 105,694,280 Y1610* probably null Het
Dock5 A G 14: 67,767,371 V1529A probably benign Het
Egfr G T 11: 16,867,300 probably benign Het
Exph5 T A 9: 53,375,796 H1392Q probably benign Het
Fam78b A G 1: 167,078,763 K164E possibly damaging Het
Fignl2 C A 15: 101,052,853 R516L unknown Het
Fndc7 C T 3: 108,867,212 E577K probably benign Het
Fryl T C 5: 73,132,562 E107G probably benign Het
Gbp10 A T 5: 105,220,965 M336K probably damaging Het
Gm11444 A T 11: 85,846,897 C156S Het
Gm6904 A T 14: 59,244,813 C164S probably damaging Het
Gm996 C A 2: 25,577,802 R699L possibly damaging Het
Golga3 C A 5: 110,202,855 A752E probably benign Het
Gper1 G T 5: 139,425,935 V12L probably benign Het
Hmbox1 G T 14: 64,823,640 A394E probably damaging Het
Ighv1-71 T A 12: 115,742,335 I77L probably benign Het
Ing4 A T 6: 125,047,932 N214Y probably damaging Het
Ints8 A G 4: 11,208,824 probably null Het
Itpa T A 2: 130,675,719 V129E probably damaging Het
Itpripl1 T A 2: 127,141,342 M287L probably benign Het
Ky T A 9: 102,525,391 probably benign Het
Lasp1 A G 11: 97,806,883 N43S possibly damaging Het
Limk2 A G 11: 3,350,763 M380T probably benign Het
Lrp2 T A 2: 69,459,613 E3627D probably damaging Het
Lrrc25 T C 8: 70,617,809 L80P probably damaging Het
Mcoln3 A T 3: 146,140,521 K529* probably null Het
Mdn1 A C 4: 32,725,854 D2591A probably damaging Het
Med12l A G 3: 59,252,330 I1267V probably benign Het
Mei4 C A 9: 81,927,542 S226* probably null Het
Mios G A 6: 8,234,255 V809M probably benign Het
Mmp17 G A 5: 129,595,422 R146Q possibly damaging Het
Mob3a G A 10: 80,691,384 Q36* probably null Het
Myo3a T A 2: 22,291,796 probably benign Het
Naca A T 10: 128,048,074 I2125F probably damaging Het
Ndst3 A C 3: 123,528,915 S840A probably benign Het
Nlrp4c T C 7: 6,065,604 M168T probably damaging Het
Nt5c3 A G 6: 56,897,773 probably null Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr1489 T C 19: 13,634,037 S309P probably benign Het
Olfr366 T A 2: 37,219,944 S152T probably damaging Het
Olfr774 T A 10: 129,238,809 I220N possibly damaging Het
Pcgf3 A G 5: 108,486,197 D107G probably benign Het
Pde2a A G 7: 101,510,381 D816G probably damaging Het
Phf10 T A 17: 14,955,999 T131S possibly damaging Het
Phrf1 A G 7: 141,232,533 D70G unknown Het
Piezo2 A G 18: 63,093,015 L850S probably damaging Het
Plcg1 T A 2: 160,754,553 probably benign Het
Plekhh2 A T 17: 84,574,993 I676L probably benign Het
Ppp1r9a T G 6: 5,115,196 V804G probably damaging Het
Ppt2 T C 17: 34,625,639 H180R possibly damaging Het
Prdm15 T C 16: 97,816,866 H398R unknown Het
Rab26 A T 17: 24,529,798 M208K probably damaging Het
Rab31 A C 17: 65,667,864 probably benign Het
Radil A G 5: 142,485,449 V1024A probably damaging Het
Rorb A G 19: 18,983,416 I65T probably damaging Het
Sall1 A T 8: 89,032,855 V207E probably damaging Het
Sart3 A T 5: 113,744,667 M864K possibly damaging Het
Sdcbp2 T A 2: 151,589,537 S277T probably benign Het
Sept5 A G 16: 18,624,872 V100A probably benign Het
Sipa1 C T 19: 5,660,952 R10Q probably damaging Het
Ski A T 4: 155,160,662 S376T probably damaging Het
Slc15a4 A T 5: 127,596,651 D566E probably benign Het
Srgap2 G A 1: 131,345,806 Q372* probably null Het
Stard9 A G 2: 120,703,578 T3439A probably damaging Het
Tln1 T C 4: 43,534,769 probably benign Het
Tmco3 A G 8: 13,295,998 M279V probably benign Het
Tmem39b T C 4: 129,676,398 probably benign Het
Trio T A 15: 27,732,546 N3083I probably damaging Het
Ube3b G A 5: 114,393,090 R215Q probably benign Het
Ubr1 T C 2: 120,866,483 N1646S probably benign Het
Uqcrc1 T G 9: 108,947,040 F270C probably damaging Het
Vmn2r108 T A 17: 20,462,425 N839I probably damaging Het
Vmn2r75 A T 7: 86,163,268 S514R probably damaging Het
Wdfy4 C G 14: 32,967,532 V3016L Het
Wdr11 A G 7: 129,599,056 N77S probably benign Het
Wdr17 C A 8: 54,640,092 probably benign Het
Wrn T A 8: 33,292,643 N753I probably damaging Het
Zan A G 5: 137,463,277 probably null Het
Zfat T A 15: 68,084,429 T1203S possibly damaging Het
Zfhx2 A C 14: 55,075,052 S62A probably benign Het
Other mutations in Klc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Klc3 APN 7 19396295 missense possibly damaging 0.78
IGL02215:Klc3 APN 7 19395825 missense probably damaging 1.00
IGL02530:Klc3 APN 7 19397044 missense probably benign 0.11
IGL03062:Klc3 APN 7 19395062 missense probably damaging 1.00
IGL02802:Klc3 UTSW 7 19395124 missense possibly damaging 0.86
R0164:Klc3 UTSW 7 19394926 missense possibly damaging 0.68
R0164:Klc3 UTSW 7 19394926 missense possibly damaging 0.68
R1864:Klc3 UTSW 7 19398041 missense probably damaging 0.98
R4702:Klc3 UTSW 7 19395831 missense probably damaging 1.00
R5301:Klc3 UTSW 7 19396349 missense probably damaging 1.00
R5436:Klc3 UTSW 7 19397959 splice site probably null
R5497:Klc3 UTSW 7 19394670 missense probably benign
R5523:Klc3 UTSW 7 19397007 missense probably damaging 1.00
R5672:Klc3 UTSW 7 19396331 missense probably damaging 1.00
R5822:Klc3 UTSW 7 19395799 critical splice donor site probably null
R6576:Klc3 UTSW 7 19397980 missense possibly damaging 0.75
R7345:Klc3 UTSW 7 19394889 missense probably benign 0.00
R9762:Klc3 UTSW 7 19398098 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTCAGTGGGTGAAATGTTCG -3'
(R):5'- GACAGTGGCATCTCATGGAC -3'

Sequencing Primer
(F):5'- TGAAATGTTCGGGGTCACC -3'
(R):5'- GGCATCTCATGGACCACCTTATG -3'
Posted On 2021-04-30