Incidental Mutation 'R8708:Egfr'
ID 669384
Institutional Source Beutler Lab
Gene Symbol Egfr
Ensembl Gene ENSMUSG00000020122
Gene Name epidermal growth factor receptor
Synonyms 9030024J15Rik, avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, Errb1, Erbb
MMRRC Submission 068562-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.933) question?
Stock # R8708 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 16702203-16868158 bp(+) (GRCm39)
Type of Mutation critical splice donor site
DNA Base Change (assembly) G to T at 16817300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884]
AlphaFold Q01279
Predicted Effect probably benign
Transcript: ENSMUST00000020329
SMART Domains Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-32 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1.8e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102884
SMART Domains Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 5e-33 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 2e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.54e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,403,400 (GRCm39) K230R probably damaging Het
Ajm1 C A 2: 25,467,814 (GRCm39) R699L possibly damaging Het
Akp3 T A 1: 87,054,091 (GRCm39) Y236* probably null Het
Alg11 T C 8: 22,555,129 (GRCm39) F130S probably damaging Het
Ankfn1 A T 11: 89,394,756 (GRCm39) S276R possibly damaging Het
Ankhd1 T A 18: 36,727,344 (GRCm39) H486Q probably damaging Het
Ankrd23 T C 1: 36,573,169 (GRCm39) T68A probably benign Het
Arhgap23 A G 11: 97,343,238 (GRCm39) T507A probably benign Het
Arid1a A T 4: 133,409,145 (GRCm39) D1787E unknown Het
Atad2b T A 12: 5,011,253 (GRCm39) D504E probably damaging Het
Atg2b T A 12: 105,635,687 (GRCm39) probably benign Het
Bptf C A 11: 106,964,139 (GRCm39) S1685I probably damaging Het
Bptf T A 11: 106,964,140 (GRCm39) S1685C probably damaging Het
Cacna1c A T 6: 118,604,416 (GRCm39) I1437N Het
Capn1 T C 19: 6,061,328 (GRCm39) K197E probably damaging Het
Ccdc177 T C 12: 80,805,891 (GRCm39) T128A probably benign Het
Ccdc7b G T 8: 129,863,095 (GRCm39) M9I probably benign Het
Celf1 T A 2: 90,840,925 (GRCm39) probably null Het
Ckap5 T A 2: 91,425,823 (GRCm39) N1285K probably benign Het
Col24a1 C T 3: 145,251,020 (GRCm39) T1673I probably damaging Het
Dbp A G 7: 45,359,225 (GRCm39) E300G probably damaging Het
Dchs2 C A 3: 83,036,049 (GRCm39) H265Q probably benign Het
Dicer1 A T 12: 104,694,704 (GRCm39) S198T possibly damaging Het
Dnase1l2 A T 17: 24,661,266 (GRCm39) F86L probably benign Het
Dnhd1 T G 7: 105,343,487 (GRCm39) Y1610* probably null Het
Dock5 A G 14: 68,004,820 (GRCm39) V1529A probably benign Het
Exph5 T A 9: 53,287,096 (GRCm39) H1392Q probably benign Het
Fam78b A G 1: 166,906,332 (GRCm39) K164E possibly damaging Het
Fignl2 C A 15: 100,950,734 (GRCm39) R516L unknown Het
Fndc7 C T 3: 108,774,528 (GRCm39) E577K probably benign Het
Fryl T C 5: 73,289,905 (GRCm39) E107G probably benign Het
Gbp10 A T 5: 105,368,831 (GRCm39) M336K probably damaging Het
Gm11444 A T 11: 85,737,723 (GRCm39) C156S Het
Golga3 C A 5: 110,350,721 (GRCm39) A752E probably benign Het
Gper1 G T 5: 139,411,690 (GRCm39) V12L probably benign Het
Hmbox1 G T 14: 65,061,089 (GRCm39) A394E probably damaging Het
Ighv1-71 T A 12: 115,705,955 (GRCm39) I77L probably benign Het
Ing4 A T 6: 125,024,895 (GRCm39) N214Y probably damaging Het
Ints8 A G 4: 11,208,824 (GRCm39) probably null Het
Itpa T A 2: 130,517,639 (GRCm39) V129E probably damaging Het
Itpripl1 T A 2: 126,983,262 (GRCm39) M287L probably benign Het
Klc3 T C 7: 19,129,784 (GRCm39) I362V probably damaging Het
Ky T A 9: 102,402,590 (GRCm39) probably benign Het
Lasp1 A G 11: 97,697,709 (GRCm39) N43S possibly damaging Het
Limk2 A G 11: 3,300,763 (GRCm39) M380T probably benign Het
Lrp2 T A 2: 69,289,957 (GRCm39) E3627D probably damaging Het
Lrrc25 T C 8: 71,070,459 (GRCm39) L80P probably damaging Het
Mcoln3 A T 3: 145,846,276 (GRCm39) K529* probably null Het
Mdn1 A C 4: 32,725,854 (GRCm39) D2591A probably damaging Het
Med12l A G 3: 59,159,751 (GRCm39) I1267V probably benign Het
Mei4 C A 9: 81,809,595 (GRCm39) S226* probably null Het
Mios G A 6: 8,234,255 (GRCm39) V809M probably benign Het
Mmp17 G A 5: 129,672,486 (GRCm39) R146Q possibly damaging Het
Mob3a G A 10: 80,527,218 (GRCm39) Q36* probably null Het
Myo3a T A 2: 22,296,607 (GRCm39) probably benign Het
Naca A T 10: 127,883,943 (GRCm39) I2125F probably damaging Het
Ndst3 A C 3: 123,322,564 (GRCm39) S840A probably benign Het
Nlrp4c T C 7: 6,068,603 (GRCm39) M168T probably damaging Het
Nt5c3 A G 6: 56,874,758 (GRCm39) probably null Het
Or1af1 T A 2: 37,109,956 (GRCm39) S152T probably damaging Het
Or4a72 C A 2: 89,405,623 (GRCm39) G149V probably damaging Het
Or5b124 T C 19: 13,611,401 (GRCm39) S309P probably benign Het
Or6c5 T A 10: 129,074,678 (GRCm39) I220N possibly damaging Het
Pcgf3 A G 5: 108,634,063 (GRCm39) D107G probably benign Het
Pde2a A G 7: 101,159,588 (GRCm39) D816G probably damaging Het
Phf10 T A 17: 15,176,261 (GRCm39) T131S possibly damaging Het
Phf11 A T 14: 59,482,262 (GRCm39) C164S probably damaging Het
Phrf1 A G 7: 140,812,446 (GRCm39) D70G unknown Het
Piezo2 A G 18: 63,226,086 (GRCm39) L850S probably damaging Het
Plcg1 T A 2: 160,596,473 (GRCm39) probably benign Het
Plekhh2 A T 17: 84,882,421 (GRCm39) I676L probably benign Het
Ppp1r9a T G 6: 5,115,196 (GRCm39) V804G probably damaging Het
Ppt2 T C 17: 34,844,613 (GRCm39) H180R possibly damaging Het
Prdm15 T C 16: 97,618,066 (GRCm39) H398R unknown Het
Rab26 A T 17: 24,748,772 (GRCm39) M208K probably damaging Het
Rab31 A C 17: 65,974,859 (GRCm39) probably benign Het
Radil A G 5: 142,471,204 (GRCm39) V1024A probably damaging Het
Rorb A G 19: 18,960,780 (GRCm39) I65T probably damaging Het
Sall1 A T 8: 89,759,483 (GRCm39) V207E probably damaging Het
Sart3 A T 5: 113,882,728 (GRCm39) M864K possibly damaging Het
Sdcbp2 T A 2: 151,431,457 (GRCm39) S277T probably benign Het
Septin5 A G 16: 18,443,622 (GRCm39) V100A probably benign Het
Sipa1 C T 19: 5,710,980 (GRCm39) R10Q probably damaging Het
Ski A T 4: 155,245,119 (GRCm39) S376T probably damaging Het
Slc15a4 A T 5: 127,673,715 (GRCm39) D566E probably benign Het
Srgap2 G A 1: 131,273,544 (GRCm39) Q372* probably null Het
Stard9 A G 2: 120,534,059 (GRCm39) T3439A probably damaging Het
Tln1 T C 4: 43,534,769 (GRCm39) probably benign Het
Tmco3 A G 8: 13,345,998 (GRCm39) M279V probably benign Het
Tmem39b T C 4: 129,570,191 (GRCm39) probably benign Het
Trio T A 15: 27,732,632 (GRCm39) N3083I probably damaging Het
Ube3b G A 5: 114,531,151 (GRCm39) R215Q probably benign Het
Ubr1 T C 2: 120,696,964 (GRCm39) N1646S probably benign Het
Uqcrc1 T G 9: 108,776,108 (GRCm39) F270C probably damaging Het
Vmn2r108 T A 17: 20,682,687 (GRCm39) N839I probably damaging Het
Vmn2r75 A T 7: 85,812,476 (GRCm39) S514R probably damaging Het
Wdfy4 C G 14: 32,689,489 (GRCm39) V3016L Het
Wdr11 A G 7: 129,200,780 (GRCm39) N77S probably benign Het
Wdr17 C A 8: 55,093,127 (GRCm39) probably benign Het
Wrn T A 8: 33,782,671 (GRCm39) N753I probably damaging Het
Zan A G 5: 137,461,539 (GRCm39) probably null Het
Zfat T A 15: 67,956,278 (GRCm39) T1203S possibly damaging Het
Zfhx2 A C 14: 55,312,509 (GRCm39) S62A probably benign Het
Other mutations in Egfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Egfr APN 11 16,813,020 (GRCm39) missense probably damaging 1.00
IGL01529:Egfr APN 11 16,813,014 (GRCm39) missense probably benign
IGL01556:Egfr APN 11 16,855,382 (GRCm39) missense probably damaging 1.00
IGL02627:Egfr APN 11 16,819,346 (GRCm39) missense probably damaging 1.00
IGL02862:Egfr APN 11 16,833,562 (GRCm39) missense probably benign 0.25
IGL02945:Egfr APN 11 16,702,514 (GRCm39) missense probably damaging 1.00
IGL02994:Egfr APN 11 16,861,811 (GRCm39) missense probably damaging 1.00
IGL03395:Egfr APN 11 16,860,261 (GRCm39) splice site probably benign
set UTSW 11 16,821,881 (GRCm39) splice site probably benign
Velvet UTSW 11 16,854,399 (GRCm39) missense probably damaging 1.00
PIT1430001:Egfr UTSW 11 16,860,214 (GRCm39) missense probably benign 0.00
R0196:Egfr UTSW 11 16,861,746 (GRCm39) missense probably benign 0.02
R0513:Egfr UTSW 11 16,822,855 (GRCm39) missense probably damaging 1.00
R0567:Egfr UTSW 11 16,822,873 (GRCm39) missense probably benign 0.01
R0629:Egfr UTSW 11 16,819,333 (GRCm39) missense probably damaging 1.00
R0961:Egfr UTSW 11 16,812,964 (GRCm39) missense probably damaging 1.00
R1163:Egfr UTSW 11 16,833,546 (GRCm39) missense probably benign 0.02
R1454:Egfr UTSW 11 16,839,920 (GRCm39) missense probably benign
R1456:Egfr UTSW 11 16,813,065 (GRCm39) missense probably benign 0.00
R1503:Egfr UTSW 11 16,819,301 (GRCm39) missense possibly damaging 0.86
R1577:Egfr UTSW 11 16,819,241 (GRCm39) missense probably benign 0.04
R1595:Egfr UTSW 11 16,856,847 (GRCm39) missense probably damaging 0.99
R1699:Egfr UTSW 11 16,809,019 (GRCm39) missense probably benign 0.14
R2172:Egfr UTSW 11 16,861,562 (GRCm39) missense probably benign 0.00
R3690:Egfr UTSW 11 16,821,881 (GRCm39) splice site probably benign
R3922:Egfr UTSW 11 16,831,495 (GRCm39) missense probably damaging 1.00
R4444:Egfr UTSW 11 16,821,027 (GRCm39) missense probably benign 0.00
R4685:Egfr UTSW 11 16,808,980 (GRCm39) missense probably damaging 1.00
R4737:Egfr UTSW 11 16,819,231 (GRCm39) missense probably damaging 0.99
R4814:Egfr UTSW 11 16,819,354 (GRCm39) missense probably damaging 1.00
R4841:Egfr UTSW 11 16,861,607 (GRCm39) missense probably benign 0.05
R4842:Egfr UTSW 11 16,861,607 (GRCm39) missense probably benign 0.05
R4903:Egfr UTSW 11 16,858,949 (GRCm39) missense probably damaging 1.00
R4964:Egfr UTSW 11 16,858,949 (GRCm39) missense probably damaging 1.00
R4985:Egfr UTSW 11 16,809,029 (GRCm39) nonsense probably null
R4998:Egfr UTSW 11 16,831,493 (GRCm39) missense possibly damaging 0.58
R5001:Egfr UTSW 11 16,854,434 (GRCm39) missense probably damaging 0.98
R5304:Egfr UTSW 11 16,834,260 (GRCm39) missense probably benign
R5309:Egfr UTSW 11 16,861,703 (GRCm39) missense probably benign 0.00
R5653:Egfr UTSW 11 16,861,617 (GRCm39) missense probably benign 0.04
R5905:Egfr UTSW 11 16,861,494 (GRCm39) missense probably damaging 1.00
R6051:Egfr UTSW 11 16,833,607 (GRCm39) missense possibly damaging 0.87
R6052:Egfr UTSW 11 16,861,554 (GRCm39) missense probably benign 0.16
R6114:Egfr UTSW 11 16,854,374 (GRCm39) missense possibly damaging 0.46
R6261:Egfr UTSW 11 16,839,964 (GRCm39) missense probably benign 0.11
R6434:Egfr UTSW 11 16,819,294 (GRCm39) missense probably benign 0.25
R6475:Egfr UTSW 11 16,841,259 (GRCm39) missense probably benign
R6799:Egfr UTSW 11 16,846,952 (GRCm39) missense probably damaging 1.00
R7143:Egfr UTSW 11 16,821,627 (GRCm39) missense probably benign 0.20
R7195:Egfr UTSW 11 16,818,162 (GRCm39) missense probably damaging 1.00
R7459:Egfr UTSW 11 16,846,967 (GRCm39) missense probably damaging 1.00
R7612:Egfr UTSW 11 16,809,025 (GRCm39) missense possibly damaging 0.74
R7757:Egfr UTSW 11 16,839,966 (GRCm39) missense possibly damaging 0.64
R7763:Egfr UTSW 11 16,841,266 (GRCm39) missense probably damaging 1.00
R8315:Egfr UTSW 11 16,825,027 (GRCm39) missense probably benign 0.08
R8320:Egfr UTSW 11 16,841,251 (GRCm39) missense probably damaging 1.00
R8324:Egfr UTSW 11 16,858,885 (GRCm39) missense probably damaging 0.98
R8324:Egfr UTSW 11 16,808,971 (GRCm39) missense probably damaging 0.99
R8347:Egfr UTSW 11 16,828,174 (GRCm39) missense probably damaging 1.00
R8440:Egfr UTSW 11 16,859,831 (GRCm39) missense probably damaging 1.00
R8511:Egfr UTSW 11 16,846,949 (GRCm39) missense probably damaging 1.00
R8804:Egfr UTSW 11 16,819,339 (GRCm39) missense probably benign 0.09
R8853:Egfr UTSW 11 16,858,885 (GRCm39) missense possibly damaging 0.93
R8906:Egfr UTSW 11 16,861,635 (GRCm39) missense probably damaging 1.00
R9177:Egfr UTSW 11 16,855,410 (GRCm39) missense probably damaging 1.00
R9268:Egfr UTSW 11 16,855,410 (GRCm39) missense probably damaging 1.00
R9335:Egfr UTSW 11 16,820,991 (GRCm39) missense probably damaging 1.00
R9417:Egfr UTSW 11 16,825,067 (GRCm39) nonsense probably null
R9454:Egfr UTSW 11 16,837,155 (GRCm39) missense probably damaging 1.00
Z1177:Egfr UTSW 11 16,819,319 (GRCm39) missense probably damaging 1.00
Z1177:Egfr UTSW 11 16,812,954 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAAGCTGTTCCTCATTTCTAGGAC -3'
(R):5'- TGTCACCATGGACACTTGGG -3'

Sequencing Primer
(F):5'- AGGACATTCTTTAGGACCTTGAGAG -3'
(R):5'- CCCACGTAGTAAGCCTTAGATAGTTG -3'
Posted On 2021-04-30