Incidental Mutation 'R8708:Ankfn1'
ID 669386
Institutional Source Beutler Lab
Gene Symbol Ankfn1
Ensembl Gene ENSMUSG00000047773
Gene Name ankyrin-repeat and fibronectin type III domain containing 1
Synonyms LOC382543, 4932411E22Rik, nmf9, mWAKE
MMRRC Submission 068562-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.390) question?
Stock # R8708 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 89280918-89668727 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89394756 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 276 (S276R)
Ref Sequence ENSEMBL: ENSMUSP00000132133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128717] [ENSMUST00000169201]
AlphaFold A0A571BF63
Predicted Effect
SMART Domains Protein: ENSMUSP00000121290
Gene: ENSMUSG00000047773
AA Change: S296R

DomainStartEndE-ValueType
ANK 136 167 2.47e2 SMART
ANK 173 204 1.46e-2 SMART
coiled coil region 205 236 N/A INTRINSIC
FN3 271 356 1.66e-7 SMART
low complexity region 586 597 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169201
AA Change: S276R

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132133
Gene: ENSMUSG00000047773
AA Change: S276R

DomainStartEndE-ValueType
ANK 116 147 2.47e2 SMART
ANK 153 184 1.46e-2 SMART
coiled coil region 185 216 N/A INTRINSIC
FN3 251 336 1.66e-7 SMART
low complexity region 566 577 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (99/101)
MGI Phenotype PHENOTYPE: Mutant mice exhibit a variable and subtle head nodding phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,403,400 (GRCm39) K230R probably damaging Het
Ajm1 C A 2: 25,467,814 (GRCm39) R699L possibly damaging Het
Akp3 T A 1: 87,054,091 (GRCm39) Y236* probably null Het
Alg11 T C 8: 22,555,129 (GRCm39) F130S probably damaging Het
Ankhd1 T A 18: 36,727,344 (GRCm39) H486Q probably damaging Het
Ankrd23 T C 1: 36,573,169 (GRCm39) T68A probably benign Het
Arhgap23 A G 11: 97,343,238 (GRCm39) T507A probably benign Het
Arid1a A T 4: 133,409,145 (GRCm39) D1787E unknown Het
Atad2b T A 12: 5,011,253 (GRCm39) D504E probably damaging Het
Atg2b T A 12: 105,635,687 (GRCm39) probably benign Het
Bptf C A 11: 106,964,139 (GRCm39) S1685I probably damaging Het
Bptf T A 11: 106,964,140 (GRCm39) S1685C probably damaging Het
Cacna1c A T 6: 118,604,416 (GRCm39) I1437N Het
Capn1 T C 19: 6,061,328 (GRCm39) K197E probably damaging Het
Ccdc177 T C 12: 80,805,891 (GRCm39) T128A probably benign Het
Ccdc7b G T 8: 129,863,095 (GRCm39) M9I probably benign Het
Celf1 T A 2: 90,840,925 (GRCm39) probably null Het
Ckap5 T A 2: 91,425,823 (GRCm39) N1285K probably benign Het
Col24a1 C T 3: 145,251,020 (GRCm39) T1673I probably damaging Het
Dbp A G 7: 45,359,225 (GRCm39) E300G probably damaging Het
Dchs2 C A 3: 83,036,049 (GRCm39) H265Q probably benign Het
Dicer1 A T 12: 104,694,704 (GRCm39) S198T possibly damaging Het
Dnase1l2 A T 17: 24,661,266 (GRCm39) F86L probably benign Het
Dnhd1 T G 7: 105,343,487 (GRCm39) Y1610* probably null Het
Dock5 A G 14: 68,004,820 (GRCm39) V1529A probably benign Het
Egfr G T 11: 16,817,300 (GRCm39) probably benign Het
Exph5 T A 9: 53,287,096 (GRCm39) H1392Q probably benign Het
Fam78b A G 1: 166,906,332 (GRCm39) K164E possibly damaging Het
Fignl2 C A 15: 100,950,734 (GRCm39) R516L unknown Het
Fndc7 C T 3: 108,774,528 (GRCm39) E577K probably benign Het
Fryl T C 5: 73,289,905 (GRCm39) E107G probably benign Het
Gbp10 A T 5: 105,368,831 (GRCm39) M336K probably damaging Het
Gm11444 A T 11: 85,737,723 (GRCm39) C156S Het
Golga3 C A 5: 110,350,721 (GRCm39) A752E probably benign Het
Gper1 G T 5: 139,411,690 (GRCm39) V12L probably benign Het
Hmbox1 G T 14: 65,061,089 (GRCm39) A394E probably damaging Het
Ighv1-71 T A 12: 115,705,955 (GRCm39) I77L probably benign Het
Ing4 A T 6: 125,024,895 (GRCm39) N214Y probably damaging Het
Ints8 A G 4: 11,208,824 (GRCm39) probably null Het
Itpa T A 2: 130,517,639 (GRCm39) V129E probably damaging Het
Itpripl1 T A 2: 126,983,262 (GRCm39) M287L probably benign Het
Klc3 T C 7: 19,129,784 (GRCm39) I362V probably damaging Het
Ky T A 9: 102,402,590 (GRCm39) probably benign Het
Lasp1 A G 11: 97,697,709 (GRCm39) N43S possibly damaging Het
Limk2 A G 11: 3,300,763 (GRCm39) M380T probably benign Het
Lrp2 T A 2: 69,289,957 (GRCm39) E3627D probably damaging Het
Lrrc25 T C 8: 71,070,459 (GRCm39) L80P probably damaging Het
Mcoln3 A T 3: 145,846,276 (GRCm39) K529* probably null Het
Mdn1 A C 4: 32,725,854 (GRCm39) D2591A probably damaging Het
Med12l A G 3: 59,159,751 (GRCm39) I1267V probably benign Het
Mei4 C A 9: 81,809,595 (GRCm39) S226* probably null Het
Mios G A 6: 8,234,255 (GRCm39) V809M probably benign Het
Mmp17 G A 5: 129,672,486 (GRCm39) R146Q possibly damaging Het
Mob3a G A 10: 80,527,218 (GRCm39) Q36* probably null Het
Myo3a T A 2: 22,296,607 (GRCm39) probably benign Het
Naca A T 10: 127,883,943 (GRCm39) I2125F probably damaging Het
Ndst3 A C 3: 123,322,564 (GRCm39) S840A probably benign Het
Nlrp4c T C 7: 6,068,603 (GRCm39) M168T probably damaging Het
Nt5c3 A G 6: 56,874,758 (GRCm39) probably null Het
Or1af1 T A 2: 37,109,956 (GRCm39) S152T probably damaging Het
Or4a72 C A 2: 89,405,623 (GRCm39) G149V probably damaging Het
Or5b124 T C 19: 13,611,401 (GRCm39) S309P probably benign Het
Or6c5 T A 10: 129,074,678 (GRCm39) I220N possibly damaging Het
Pcgf3 A G 5: 108,634,063 (GRCm39) D107G probably benign Het
Pde2a A G 7: 101,159,588 (GRCm39) D816G probably damaging Het
Phf10 T A 17: 15,176,261 (GRCm39) T131S possibly damaging Het
Phf11 A T 14: 59,482,262 (GRCm39) C164S probably damaging Het
Phrf1 A G 7: 140,812,446 (GRCm39) D70G unknown Het
Piezo2 A G 18: 63,226,086 (GRCm39) L850S probably damaging Het
Plcg1 T A 2: 160,596,473 (GRCm39) probably benign Het
Plekhh2 A T 17: 84,882,421 (GRCm39) I676L probably benign Het
Ppp1r9a T G 6: 5,115,196 (GRCm39) V804G probably damaging Het
Ppt2 T C 17: 34,844,613 (GRCm39) H180R possibly damaging Het
Prdm15 T C 16: 97,618,066 (GRCm39) H398R unknown Het
Rab26 A T 17: 24,748,772 (GRCm39) M208K probably damaging Het
Rab31 A C 17: 65,974,859 (GRCm39) probably benign Het
Radil A G 5: 142,471,204 (GRCm39) V1024A probably damaging Het
Rorb A G 19: 18,960,780 (GRCm39) I65T probably damaging Het
Sall1 A T 8: 89,759,483 (GRCm39) V207E probably damaging Het
Sart3 A T 5: 113,882,728 (GRCm39) M864K possibly damaging Het
Sdcbp2 T A 2: 151,431,457 (GRCm39) S277T probably benign Het
Septin5 A G 16: 18,443,622 (GRCm39) V100A probably benign Het
Sipa1 C T 19: 5,710,980 (GRCm39) R10Q probably damaging Het
Ski A T 4: 155,245,119 (GRCm39) S376T probably damaging Het
Slc15a4 A T 5: 127,673,715 (GRCm39) D566E probably benign Het
Srgap2 G A 1: 131,273,544 (GRCm39) Q372* probably null Het
Stard9 A G 2: 120,534,059 (GRCm39) T3439A probably damaging Het
Tln1 T C 4: 43,534,769 (GRCm39) probably benign Het
Tmco3 A G 8: 13,345,998 (GRCm39) M279V probably benign Het
Tmem39b T C 4: 129,570,191 (GRCm39) probably benign Het
Trio T A 15: 27,732,632 (GRCm39) N3083I probably damaging Het
Ube3b G A 5: 114,531,151 (GRCm39) R215Q probably benign Het
Ubr1 T C 2: 120,696,964 (GRCm39) N1646S probably benign Het
Uqcrc1 T G 9: 108,776,108 (GRCm39) F270C probably damaging Het
Vmn2r108 T A 17: 20,682,687 (GRCm39) N839I probably damaging Het
Vmn2r75 A T 7: 85,812,476 (GRCm39) S514R probably damaging Het
Wdfy4 C G 14: 32,689,489 (GRCm39) V3016L Het
Wdr11 A G 7: 129,200,780 (GRCm39) N77S probably benign Het
Wdr17 C A 8: 55,093,127 (GRCm39) probably benign Het
Wrn T A 8: 33,782,671 (GRCm39) N753I probably damaging Het
Zan A G 5: 137,461,539 (GRCm39) probably null Het
Zfat T A 15: 67,956,278 (GRCm39) T1203S possibly damaging Het
Zfhx2 A C 14: 55,312,509 (GRCm39) S62A probably benign Het
Other mutations in Ankfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Ankfn1 APN 11 89,282,465 (GRCm39) missense probably benign 0.01
IGL02519:Ankfn1 APN 11 89,296,504 (GRCm39) missense probably benign
IGL02695:Ankfn1 APN 11 89,282,645 (GRCm39) missense probably damaging 0.99
IGL02818:Ankfn1 APN 11 89,429,292 (GRCm39) missense probably benign
IGL02821:Ankfn1 APN 11 89,282,442 (GRCm39) missense probably benign 0.00
IGL03166:Ankfn1 APN 11 89,429,264 (GRCm39) missense probably benign 0.19
R0056:Ankfn1 UTSW 11 89,282,502 (GRCm39) missense possibly damaging 0.71
R0070:Ankfn1 UTSW 11 89,283,128 (GRCm39) missense probably damaging 0.99
R0070:Ankfn1 UTSW 11 89,283,128 (GRCm39) missense probably damaging 0.99
R0200:Ankfn1 UTSW 11 89,332,792 (GRCm39) missense possibly damaging 0.67
R0427:Ankfn1 UTSW 11 89,296,423 (GRCm39) missense probably damaging 0.99
R0755:Ankfn1 UTSW 11 89,282,913 (GRCm39) missense probably benign
R1240:Ankfn1 UTSW 11 89,282,960 (GRCm39) missense probably damaging 0.99
R1534:Ankfn1 UTSW 11 89,413,977 (GRCm39) missense probably damaging 1.00
R1539:Ankfn1 UTSW 11 89,332,217 (GRCm39) missense probably damaging 1.00
R1548:Ankfn1 UTSW 11 89,417,367 (GRCm39) missense probably damaging 0.98
R1595:Ankfn1 UTSW 11 89,313,593 (GRCm39) critical splice donor site probably null
R1776:Ankfn1 UTSW 11 89,417,300 (GRCm39) missense possibly damaging 0.74
R1835:Ankfn1 UTSW 11 89,338,444 (GRCm39) missense probably benign 0.25
R2012:Ankfn1 UTSW 11 89,296,423 (GRCm39) missense probably damaging 0.99
R2037:Ankfn1 UTSW 11 89,346,946 (GRCm39) missense probably benign 0.13
R2175:Ankfn1 UTSW 11 89,417,363 (GRCm39) missense probably damaging 1.00
R2876:Ankfn1 UTSW 11 89,282,462 (GRCm39) missense possibly damaging 0.90
R3778:Ankfn1 UTSW 11 89,332,220 (GRCm39) missense probably damaging 1.00
R4720:Ankfn1 UTSW 11 89,332,252 (GRCm39) missense possibly damaging 0.50
R5001:Ankfn1 UTSW 11 89,332,268 (GRCm39) missense possibly damaging 0.85
R5318:Ankfn1 UTSW 11 89,282,754 (GRCm39) missense probably damaging 0.96
R5412:Ankfn1 UTSW 11 89,396,007 (GRCm39) missense probably benign 0.17
R5434:Ankfn1 UTSW 11 89,344,013 (GRCm39) missense probably damaging 1.00
R5458:Ankfn1 UTSW 11 89,325,636 (GRCm39) missense probably benign 0.00
R5710:Ankfn1 UTSW 11 89,394,751 (GRCm39) missense probably benign 0.02
R6457:Ankfn1 UTSW 11 89,282,670 (GRCm39) missense probably benign 0.00
R7026:Ankfn1 UTSW 11 89,530,403 (GRCm39) makesense probably null
R7356:Ankfn1 UTSW 11 89,325,599 (GRCm39) missense probably damaging 0.97
R7499:Ankfn1 UTSW 11 89,282,576 (GRCm39) missense probably benign 0.12
R7572:Ankfn1 UTSW 11 89,312,097 (GRCm39) missense probably benign
R7577:Ankfn1 UTSW 11 89,394,797 (GRCm39) missense probably benign 0.04
R7582:Ankfn1 UTSW 11 89,417,445 (GRCm39) missense probably benign 0.04
R7820:Ankfn1 UTSW 11 89,311,956 (GRCm39) missense probably damaging 0.99
R7908:Ankfn1 UTSW 11 89,296,360 (GRCm39) missense probably damaging 1.00
R7992:Ankfn1 UTSW 11 89,413,859 (GRCm39) missense probably benign 0.02
R8137:Ankfn1 UTSW 11 89,344,003 (GRCm39) missense probably benign 0.00
R8242:Ankfn1 UTSW 11 89,417,271 (GRCm39) critical splice donor site probably null
R8295:Ankfn1 UTSW 11 89,302,923 (GRCm39) missense probably benign 0.02
R8556:Ankfn1 UTSW 11 89,332,268 (GRCm39) missense possibly damaging 0.95
R8815:Ankfn1 UTSW 11 89,282,602 (GRCm39) missense probably damaging 0.96
R8835:Ankfn1 UTSW 11 89,429,379 (GRCm39) missense probably benign 0.00
R8928:Ankfn1 UTSW 11 89,429,279 (GRCm39) missense possibly damaging 0.67
R9011:Ankfn1 UTSW 11 89,417,444 (GRCm39) missense probably benign 0.00
R9062:Ankfn1 UTSW 11 89,325,583 (GRCm39) missense probably benign 0.32
R9129:Ankfn1 UTSW 11 89,312,042 (GRCm39) missense
R9153:Ankfn1 UTSW 11 89,302,845 (GRCm39) missense probably damaging 1.00
R9179:Ankfn1 UTSW 11 89,414,011 (GRCm39) missense probably benign 0.01
R9272:Ankfn1 UTSW 11 89,413,875 (GRCm39) missense probably benign 0.10
R9377:Ankfn1 UTSW 11 89,332,284 (GRCm39) missense possibly damaging 0.90
R9624:Ankfn1 UTSW 11 89,414,033 (GRCm39) missense probably benign 0.19
R9643:Ankfn1 UTSW 11 89,396,167 (GRCm39) missense probably benign 0.01
X0012:Ankfn1 UTSW 11 89,316,370 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGAATCTTCACAGTGATGTG -3'
(R):5'- TTCCTCTACCCTTTAAGGAGGC -3'

Sequencing Primer
(F):5'- AATCTTCACAGTGATGTGTGTGG -3'
(R):5'- CTACCCTTTAAGGAGGCAGAAATATG -3'
Posted On 2021-04-30