Mutagenetix > Incidental Mutation

Incidental Mutation 'R8708:Dicer1'

669393

Institutional Source

Beutler Lab

Gene Symbol

Dicer1

Ensembl Gene

ENSMUSG00000041415

Gene Name

dicer 1, ribonuclease type III

Synonyms

D12Ertd7e

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8708 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104687742-104751952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104728445 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 198 (S198T)

Ref Sequence

ENSEMBL: ENSMUSP00000043676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041987] [ENSMUST00000222002]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041987
AA Change: S198T

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: S198T

Domain	Start	End	E-Value	Type
DEXDc	30	233	5.14e-24	SMART
low complexity region	403	419	N/A	INTRINSIC
HELICc	449	546	3.15e-10	SMART
Pfam:Dicer_dimer	620	707	1.4e-25	PFAM
low complexity region	713	723	N/A	INTRINSIC
PAZ	881	1056	1.67e-48	SMART
Blast:PAZ	1080	1129	2e-8	BLAST
RIBOc	1285	1582	1.83e-35	SMART
RIBOc	1665	1831	5.97e-49	SMART
DSRM	1834	1897	6.89e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222002
AA Change: S198T

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (99/101)

MGI Phenotype

Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adra1d	T	C	2: 131,561,480	K230R	probably damaging	Het
Akp3	T	A	1: 87,126,369	Y236*	probably null	Het
Alg11	T	C	8: 22,065,113	F130S	probably damaging	Het
Ankfn1	A	T	11: 89,503,930	S276R	possibly damaging	Het
Ankhd1	T	A	18: 36,594,291	H486Q	probably damaging	Het
Ankrd23	T	C	1: 36,534,088	T68A	probably benign	Het
Arhgap23	A	G	11: 97,452,412	T507A	probably benign	Het
Arid1a	A	T	4: 133,681,834	D1787E	unknown	Het
Atad2b	T	A	12: 4,961,253	D504E	probably damaging	Het
Atg2b	T	A	12: 105,669,428		probably benign	Het
Bptf	C	A	11: 107,073,313	S1685I	probably damaging	Het
Bptf	T	A	11: 107,073,314	S1685C	probably damaging	Het
Cacna1c	A	T	6: 118,627,455	I1437N		Het
Capn1	T	C	19: 6,011,298	K197E	probably damaging	Het
Ccdc177	T	C	12: 80,759,117	T128A	probably benign	Het
Ccdc7b	G	T	8: 129,136,614	M9I	probably benign	Het
Celf1	T	A	2: 91,010,580		probably null	Het
Ckap5	T	A	2: 91,595,478	N1285K	probably benign	Het
Col24a1	C	T	3: 145,545,265	T1673I	probably damaging	Het
Dbp	A	G	7: 45,709,801	E300G	probably damaging	Het
Dchs2	C	A	3: 83,128,742	H265Q	probably benign	Het
Dnase1l2	A	T	17: 24,442,292	F86L	probably benign	Het
Dnhd1	T	G	7: 105,694,280	Y1610*	probably null	Het
Dock5	A	G	14: 67,767,371	V1529A	probably benign	Het
Egfr	G	T	11: 16,867,300		probably benign	Het
Exph5	T	A	9: 53,375,796	H1392Q	probably benign	Het
Fam78b	A	G	1: 167,078,763	K164E	possibly damaging	Het
Fignl2	C	A	15: 101,052,853	R516L	unknown	Het
Fndc7	C	T	3: 108,867,212	E577K	probably benign	Het
Fryl	T	C	5: 73,132,562	E107G	probably benign	Het
Gbp10	A	T	5: 105,220,965	M336K	probably damaging	Het
Gm11444	A	T	11: 85,846,897	C156S		Het
Gm6904	A	T	14: 59,244,813	C164S	probably damaging	Het
Gm996	C	A	2: 25,577,802	R699L	possibly damaging	Het
Golga3	C	A	5: 110,202,855	A752E	probably benign	Het
Gper1	G	T	5: 139,425,935	V12L	probably benign	Het
Hmbox1	G	T	14: 64,823,640	A394E	probably damaging	Het
Ighv1-71	T	A	12: 115,742,335	I77L	probably benign	Het
Ing4	A	T	6: 125,047,932	N214Y	probably damaging	Het
Ints8	A	G	4: 11,208,824		probably null	Het
Itpa	T	A	2: 130,675,719	V129E	probably damaging	Het
Itpripl1	T	A	2: 127,141,342	M287L	probably benign	Het
Klc3	T	C	7: 19,395,859	I362V	probably damaging	Het
Ky	T	A	9: 102,525,391		probably benign	Het
Lasp1	A	G	11: 97,806,883	N43S	possibly damaging	Het
Limk2	A	G	11: 3,350,763	M380T	probably benign	Het
Lrp2	T	A	2: 69,459,613	E3627D	probably damaging	Het
Lrrc25	T	C	8: 70,617,809	L80P	probably damaging	Het
Mcoln3	A	T	3: 146,140,521	K529*	probably null	Het
Mdn1	A	C	4: 32,725,854	D2591A	probably damaging	Het
Med12l	A	G	3: 59,252,330	I1267V	probably benign	Het
Mei4	C	A	9: 81,927,542	S226*	probably null	Het
Mios	G	A	6: 8,234,255	V809M	probably benign	Het
Mmp17	G	A	5: 129,595,422	R146Q	possibly damaging	Het
Mob3a	G	A	10: 80,691,384	Q36*	probably null	Het
Myo3a	T	A	2: 22,291,796		probably benign	Het
Naca	A	T	10: 128,048,074	I2125F	probably damaging	Het
Ndst3	A	C	3: 123,528,915	S840A	probably benign	Het
Nlrp4c	T	C	7: 6,065,604	M168T	probably damaging	Het
Nt5c3	A	G	6: 56,897,773		probably null	Het
Olfr1245	C	A	2: 89,575,279	G149V	probably damaging	Het
Olfr1489	T	C	19: 13,634,037	S309P	probably benign	Het
Olfr366	T	A	2: 37,219,944	S152T	probably damaging	Het
Olfr774	T	A	10: 129,238,809	I220N	possibly damaging	Het
Pcgf3	A	G	5: 108,486,197	D107G	probably benign	Het
Pde2a	A	G	7: 101,510,381	D816G	probably damaging	Het
Phf10	T	A	17: 14,955,999	T131S	possibly damaging	Het
Phrf1	A	G	7: 141,232,533	D70G	unknown	Het
Piezo2	A	G	18: 63,093,015	L850S	probably damaging	Het
Plcg1	T	A	2: 160,754,553		probably benign	Het
Plekhh2	A	T	17: 84,574,993	I676L	probably benign	Het
Ppp1r9a	T	G	6: 5,115,196	V804G	probably damaging	Het
Ppt2	T	C	17: 34,625,639	H180R	possibly damaging	Het
Prdm15	T	C	16: 97,816,866	H398R	unknown	Het
Rab26	A	T	17: 24,529,798	M208K	probably damaging	Het
Rab31	A	C	17: 65,667,864		probably benign	Het
Radil	A	G	5: 142,485,449	V1024A	probably damaging	Het
Rorb	A	G	19: 18,983,416	I65T	probably damaging	Het
Sall1	A	T	8: 89,032,855	V207E	probably damaging	Het
Sart3	A	T	5: 113,744,667	M864K	possibly damaging	Het
Sdcbp2	T	A	2: 151,589,537	S277T	probably benign	Het
Sept5	A	G	16: 18,624,872	V100A	probably benign	Het
Sipa1	C	T	19: 5,660,952	R10Q	probably damaging	Het
Ski	A	T	4: 155,160,662	S376T	probably damaging	Het
Slc15a4	A	T	5: 127,596,651	D566E	probably benign	Het
Srgap2	G	A	1: 131,345,806	Q372*	probably null	Het
Stard9	A	G	2: 120,703,578	T3439A	probably damaging	Het
Tln1	T	C	4: 43,534,769		probably benign	Het
Tmco3	A	G	8: 13,295,998	M279V	probably benign	Het
Tmem39b	T	C	4: 129,676,398		probably benign	Het
Trio	T	A	15: 27,732,546	N3083I	probably damaging	Het
Ube3b	G	A	5: 114,393,090	R215Q	probably benign	Het
Ubr1	T	C	2: 120,866,483	N1646S	probably benign	Het
Uqcrc1	T	G	9: 108,947,040	F270C	probably damaging	Het
Vmn2r108	T	A	17: 20,462,425	N839I	probably damaging	Het
Vmn2r75	A	T	7: 86,163,268	S514R	probably damaging	Het
Wdfy4	C	G	14: 32,967,532	V3016L		Het
Wdr11	A	G	7: 129,599,056	N77S	probably benign	Het
Wdr17	C	A	8: 54,640,092		probably benign	Het
Wrn	T	A	8: 33,292,643	N753I	probably damaging	Het
Zan	A	G	5: 137,463,277		probably null	Het
Zfat	T	A	15: 68,084,429	T1203S	possibly damaging	Het
Zfhx2	A	C	14: 55,075,052	S62A	probably benign	Het

Other mutations in Dicer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Dicer1	APN	12	104696772	missense	possibly damaging	0.93
IGL01061:Dicer1	APN	12	104706327	missense	probably null	0.75
IGL01527:Dicer1	APN	12	104691610	nonsense	probably null
IGL01597:Dicer1	APN	12	104705210	nonsense	probably null
IGL01636:Dicer1	APN	12	104722241	missense	probably damaging	1.00
IGL01717:Dicer1	APN	12	104702787	nonsense	probably null
IGL01765:Dicer1	APN	12	104706740	missense	probably damaging	1.00
IGL01871:Dicer1	APN	12	104704180	missense	probably damaging	1.00
IGL02316:Dicer1	APN	12	104702553	missense	probably damaging	1.00
IGL02317:Dicer1	APN	12	104697020	missense	probably damaging	1.00
IGL02539:Dicer1	APN	12	104697035	missense	probably damaging	0.97
IGL02544:Dicer1	APN	12	104714832	missense	probably damaging	1.00
IGL02664:Dicer1	APN	12	104705129	missense	probably damaging	1.00
IGL02667:Dicer1	APN	12	104714906	missense	probably damaging	1.00
IGL03353:Dicer1	APN	12	104713107	missense	probably damaging	1.00
IGL03377:Dicer1	APN	12	104712197	missense	probably damaging	0.98
everest	UTSW	12	104705128	missense	probably damaging	1.00
PIT4480001:Dicer1	UTSW	12	104696544	missense	probably benign
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0219:Dicer1	UTSW	12	104692125	critical splice donor site	probably null
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0385:Dicer1	UTSW	12	104704174	missense	probably damaging	1.00
R0402:Dicer1	UTSW	12	104731064	missense	probably benign	0.04
R0426:Dicer1	UTSW	12	104702542	missense	probably damaging	1.00
R0453:Dicer1	UTSW	12	104702630	missense	probably benign
R0502:Dicer1	UTSW	12	104705060	missense	probably damaging	1.00
R0507:Dicer1	UTSW	12	104691658	missense	probably damaging	1.00
R0511:Dicer1	UTSW	12	104702841	missense	possibly damaging	0.95
R0523:Dicer1	UTSW	12	104702491	missense	probably damaging	1.00
R0559:Dicer1	UTSW	12	104706301	missense	probably damaging	1.00
R0600:Dicer1	UTSW	12	104706864	missense	probably damaging	1.00
R0707:Dicer1	UTSW	12	104706885	missense	probably damaging	1.00
R1225:Dicer1	UTSW	12	104691607	missense	probably damaging	0.98
R1351:Dicer1	UTSW	12	104729142	missense	probably damaging	0.99
R1449:Dicer1	UTSW	12	104729243	missense	possibly damaging	0.85
R1575:Dicer1	UTSW	12	104721969	critical splice donor site	probably null
R1642:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R1651:Dicer1	UTSW	12	104708805	missense	probably damaging	1.00
R1658:Dicer1	UTSW	12	104700414	missense	probably benign
R1815:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1816:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1927:Dicer1	UTSW	12	104702884	missense	possibly damaging	0.91
R2113:Dicer1	UTSW	12	104713214	missense	probably damaging	1.00
R2129:Dicer1	UTSW	12	104722031	missense	probably damaging	1.00
R2157:Dicer1	UTSW	12	104702949	missense	probably benign	0.17
R2202:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R2203:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R2243:Dicer1	UTSW	12	104730188	missense	probably damaging	0.99
R4237:Dicer1	UTSW	12	104729228	missense	possibly damaging	0.48
R4419:Dicer1	UTSW	12	104705114	missense	probably damaging	1.00
R4482:Dicer1	UTSW	12	104706277	missense	probably damaging	1.00
R4564:Dicer1	UTSW	12	104704751	nonsense	probably null
R4776:Dicer1	UTSW	12	104692446	missense	probably damaging	0.99
R4834:Dicer1	UTSW	12	104696591	missense	probably benign	0.44
R4904:Dicer1	UTSW	12	104713066	missense	probably benign
R5202:Dicer1	UTSW	12	104694731	nonsense	probably null
R5272:Dicer1	UTSW	12	104704240	missense	probably damaging	1.00
R5363:Dicer1	UTSW	12	104703151	missense	probably damaging	1.00
R5717:Dicer1	UTSW	12	104705128	missense	probably damaging	1.00
R6381:Dicer1	UTSW	12	104696462	missense	probably benign	0.00
R6479:Dicer1	UTSW	12	104696723	missense	probably damaging	0.97
R6956:Dicer1	UTSW	12	104731023	missense	probably damaging	1.00
R7234:Dicer1	UTSW	12	104708849	missense	probably damaging	1.00
R7401:Dicer1	UTSW	12	104712278	missense	probably benign
R7407:Dicer1	UTSW	12	104722351	nonsense	probably null
R7471:Dicer1	UTSW	12	104694710	missense	probably damaging	1.00
R7699:Dicer1	UTSW	12	104705170	missense	probably damaging	1.00
R7768:Dicer1	UTSW	12	104706697	missense	probably damaging	0.99
R7831:Dicer1	UTSW	12	104708800	missense	probably damaging	1.00
R7998:Dicer1	UTSW	12	104704069	missense	probably damaging	1.00
R8010:Dicer1	UTSW	12	104692132	missense	probably damaging	0.99
R8061:Dicer1	UTSW	12	104702818	nonsense	probably null
R8213:Dicer1	UTSW	12	104702693	missense	probably benign	0.00
R8261:Dicer1	UTSW	12	104691606	missense	probably damaging	1.00
R8419:Dicer1	UTSW	12	104702677	missense	probably benign	0.00
R8851:Dicer1	UTSW	12	104724041	missense	possibly damaging	0.76
R9220:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R9371:Dicer1	UTSW	12	104704732	missense	probably damaging	1.00
R9387:Dicer1	UTSW	12	104729240	missense	possibly damaging	0.48
R9505:Dicer1	UTSW	12	104731038	missense	possibly damaging	0.95
R9636:Dicer1	UTSW	12	104722147	nonsense	probably null
R9682:Dicer1	UTSW	12	104706225	missense	probably damaging	1.00
X0018:Dicer1	UTSW	12	104696934	missense	probably benign	0.00
Z1176:Dicer1	UTSW	12	104731020	missense	probably null	0.97

Predicted Primers

PCR Primer
(F):5'- CAAGTGTGGGTGCACCTGAG -3'
(R):5'- TTAGTGTATCCAAATGTGCCCTTTTG -3'

Sequencing Primer
(F):5'- TGCACCTGAGCAGCTTC -3'
(R):5'- CCAAATGTGCCCTTTTGAGAAATAG -3'

Posted On

2021-04-30