Incidental Mutation 'R8708:Wdfy4'
ID 669396
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene Name WD repeat and FYVE domain containing 4
Synonyms
MMRRC Submission 068562-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8708 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 32681504-32907465 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 32689489 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 3016 (V3016L)
Ref Sequence ENSEMBL: ENSMUSP00000117068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000061753
AA Change: V2857L

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: V2857L

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: V3016L

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (99/101)
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,403,400 (GRCm39) K230R probably damaging Het
Ajm1 C A 2: 25,467,814 (GRCm39) R699L possibly damaging Het
Akp3 T A 1: 87,054,091 (GRCm39) Y236* probably null Het
Alg11 T C 8: 22,555,129 (GRCm39) F130S probably damaging Het
Ankfn1 A T 11: 89,394,756 (GRCm39) S276R possibly damaging Het
Ankhd1 T A 18: 36,727,344 (GRCm39) H486Q probably damaging Het
Ankrd23 T C 1: 36,573,169 (GRCm39) T68A probably benign Het
Arhgap23 A G 11: 97,343,238 (GRCm39) T507A probably benign Het
Arid1a A T 4: 133,409,145 (GRCm39) D1787E unknown Het
Atad2b T A 12: 5,011,253 (GRCm39) D504E probably damaging Het
Atg2b T A 12: 105,635,687 (GRCm39) probably benign Het
Bptf C A 11: 106,964,139 (GRCm39) S1685I probably damaging Het
Bptf T A 11: 106,964,140 (GRCm39) S1685C probably damaging Het
Cacna1c A T 6: 118,604,416 (GRCm39) I1437N Het
Capn1 T C 19: 6,061,328 (GRCm39) K197E probably damaging Het
Ccdc177 T C 12: 80,805,891 (GRCm39) T128A probably benign Het
Ccdc7b G T 8: 129,863,095 (GRCm39) M9I probably benign Het
Celf1 T A 2: 90,840,925 (GRCm39) probably null Het
Ckap5 T A 2: 91,425,823 (GRCm39) N1285K probably benign Het
Col24a1 C T 3: 145,251,020 (GRCm39) T1673I probably damaging Het
Dbp A G 7: 45,359,225 (GRCm39) E300G probably damaging Het
Dchs2 C A 3: 83,036,049 (GRCm39) H265Q probably benign Het
Dicer1 A T 12: 104,694,704 (GRCm39) S198T possibly damaging Het
Dnase1l2 A T 17: 24,661,266 (GRCm39) F86L probably benign Het
Dnhd1 T G 7: 105,343,487 (GRCm39) Y1610* probably null Het
Dock5 A G 14: 68,004,820 (GRCm39) V1529A probably benign Het
Egfr G T 11: 16,817,300 (GRCm39) probably benign Het
Exph5 T A 9: 53,287,096 (GRCm39) H1392Q probably benign Het
Fam78b A G 1: 166,906,332 (GRCm39) K164E possibly damaging Het
Fignl2 C A 15: 100,950,734 (GRCm39) R516L unknown Het
Fndc7 C T 3: 108,774,528 (GRCm39) E577K probably benign Het
Fryl T C 5: 73,289,905 (GRCm39) E107G probably benign Het
Gbp10 A T 5: 105,368,831 (GRCm39) M336K probably damaging Het
Gm11444 A T 11: 85,737,723 (GRCm39) C156S Het
Golga3 C A 5: 110,350,721 (GRCm39) A752E probably benign Het
Gper1 G T 5: 139,411,690 (GRCm39) V12L probably benign Het
Hmbox1 G T 14: 65,061,089 (GRCm39) A394E probably damaging Het
Ighv1-71 T A 12: 115,705,955 (GRCm39) I77L probably benign Het
Ing4 A T 6: 125,024,895 (GRCm39) N214Y probably damaging Het
Ints8 A G 4: 11,208,824 (GRCm39) probably null Het
Itpa T A 2: 130,517,639 (GRCm39) V129E probably damaging Het
Itpripl1 T A 2: 126,983,262 (GRCm39) M287L probably benign Het
Klc3 T C 7: 19,129,784 (GRCm39) I362V probably damaging Het
Ky T A 9: 102,402,590 (GRCm39) probably benign Het
Lasp1 A G 11: 97,697,709 (GRCm39) N43S possibly damaging Het
Limk2 A G 11: 3,300,763 (GRCm39) M380T probably benign Het
Lrp2 T A 2: 69,289,957 (GRCm39) E3627D probably damaging Het
Lrrc25 T C 8: 71,070,459 (GRCm39) L80P probably damaging Het
Mcoln3 A T 3: 145,846,276 (GRCm39) K529* probably null Het
Mdn1 A C 4: 32,725,854 (GRCm39) D2591A probably damaging Het
Med12l A G 3: 59,159,751 (GRCm39) I1267V probably benign Het
Mei4 C A 9: 81,809,595 (GRCm39) S226* probably null Het
Mios G A 6: 8,234,255 (GRCm39) V809M probably benign Het
Mmp17 G A 5: 129,672,486 (GRCm39) R146Q possibly damaging Het
Mob3a G A 10: 80,527,218 (GRCm39) Q36* probably null Het
Myo3a T A 2: 22,296,607 (GRCm39) probably benign Het
Naca A T 10: 127,883,943 (GRCm39) I2125F probably damaging Het
Ndst3 A C 3: 123,322,564 (GRCm39) S840A probably benign Het
Nlrp4c T C 7: 6,068,603 (GRCm39) M168T probably damaging Het
Nt5c3 A G 6: 56,874,758 (GRCm39) probably null Het
Or1af1 T A 2: 37,109,956 (GRCm39) S152T probably damaging Het
Or4a72 C A 2: 89,405,623 (GRCm39) G149V probably damaging Het
Or5b124 T C 19: 13,611,401 (GRCm39) S309P probably benign Het
Or6c5 T A 10: 129,074,678 (GRCm39) I220N possibly damaging Het
Pcgf3 A G 5: 108,634,063 (GRCm39) D107G probably benign Het
Pde2a A G 7: 101,159,588 (GRCm39) D816G probably damaging Het
Phf10 T A 17: 15,176,261 (GRCm39) T131S possibly damaging Het
Phf11 A T 14: 59,482,262 (GRCm39) C164S probably damaging Het
Phrf1 A G 7: 140,812,446 (GRCm39) D70G unknown Het
Piezo2 A G 18: 63,226,086 (GRCm39) L850S probably damaging Het
Plcg1 T A 2: 160,596,473 (GRCm39) probably benign Het
Plekhh2 A T 17: 84,882,421 (GRCm39) I676L probably benign Het
Ppp1r9a T G 6: 5,115,196 (GRCm39) V804G probably damaging Het
Ppt2 T C 17: 34,844,613 (GRCm39) H180R possibly damaging Het
Prdm15 T C 16: 97,618,066 (GRCm39) H398R unknown Het
Rab26 A T 17: 24,748,772 (GRCm39) M208K probably damaging Het
Rab31 A C 17: 65,974,859 (GRCm39) probably benign Het
Radil A G 5: 142,471,204 (GRCm39) V1024A probably damaging Het
Rorb A G 19: 18,960,780 (GRCm39) I65T probably damaging Het
Sall1 A T 8: 89,759,483 (GRCm39) V207E probably damaging Het
Sart3 A T 5: 113,882,728 (GRCm39) M864K possibly damaging Het
Sdcbp2 T A 2: 151,431,457 (GRCm39) S277T probably benign Het
Septin5 A G 16: 18,443,622 (GRCm39) V100A probably benign Het
Sipa1 C T 19: 5,710,980 (GRCm39) R10Q probably damaging Het
Ski A T 4: 155,245,119 (GRCm39) S376T probably damaging Het
Slc15a4 A T 5: 127,673,715 (GRCm39) D566E probably benign Het
Srgap2 G A 1: 131,273,544 (GRCm39) Q372* probably null Het
Stard9 A G 2: 120,534,059 (GRCm39) T3439A probably damaging Het
Tln1 T C 4: 43,534,769 (GRCm39) probably benign Het
Tmco3 A G 8: 13,345,998 (GRCm39) M279V probably benign Het
Tmem39b T C 4: 129,570,191 (GRCm39) probably benign Het
Trio T A 15: 27,732,632 (GRCm39) N3083I probably damaging Het
Ube3b G A 5: 114,531,151 (GRCm39) R215Q probably benign Het
Ubr1 T C 2: 120,696,964 (GRCm39) N1646S probably benign Het
Uqcrc1 T G 9: 108,776,108 (GRCm39) F270C probably damaging Het
Vmn2r108 T A 17: 20,682,687 (GRCm39) N839I probably damaging Het
Vmn2r75 A T 7: 85,812,476 (GRCm39) S514R probably damaging Het
Wdr11 A G 7: 129,200,780 (GRCm39) N77S probably benign Het
Wdr17 C A 8: 55,093,127 (GRCm39) probably benign Het
Wrn T A 8: 33,782,671 (GRCm39) N753I probably damaging Het
Zan A G 5: 137,461,539 (GRCm39) probably null Het
Zfat T A 15: 67,956,278 (GRCm39) T1203S possibly damaging Het
Zfhx2 A C 14: 55,312,509 (GRCm39) S62A probably benign Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 32,824,496 (GRCm39) missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32,681,934 (GRCm39) missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 32,825,994 (GRCm39) missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 32,873,618 (GRCm39) missense probably benign 0.01
IGL01700:Wdfy4 APN 14 32,742,195 (GRCm39) splice site probably benign
IGL01931:Wdfy4 APN 14 32,877,710 (GRCm39) missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 32,855,673 (GRCm39) missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 32,798,437 (GRCm39) missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 32,815,257 (GRCm39) missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 32,871,523 (GRCm39) missense probably benign
IGL02468:Wdfy4 APN 14 32,688,389 (GRCm39) missense probably benign 0.01
IGL02512:Wdfy4 APN 14 32,764,448 (GRCm39) missense probably benign 0.01
IGL02597:Wdfy4 APN 14 32,812,818 (GRCm39) nonsense probably null
IGL02752:Wdfy4 APN 14 32,798,283 (GRCm39) missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 32,817,262 (GRCm39) missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32,693,707 (GRCm39) missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 32,831,607 (GRCm39) missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 32,798,241 (GRCm39) missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 32,862,608 (GRCm39) missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32,688,392 (GRCm39) missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 32,884,827 (GRCm39) missense probably benign 0.01
IGL03198:Wdfy4 APN 14 32,847,844 (GRCm39) missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32,699,124 (GRCm39) missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 32,790,861 (GRCm39) missense probably benign 0.01
IGL03398:Wdfy4 APN 14 32,769,247 (GRCm39) missense probably benign 0.14
dodgers UTSW 14 32,699,063 (GRCm39) nonsense probably null
Dollar UTSW 14 32,742,268 (GRCm39) missense probably damaging 1.00
Giants UTSW 14 32,792,575 (GRCm39) nonsense probably null
gigantea UTSW 14 32,696,111 (GRCm39) critical splice donor site probably null
kings_canyon UTSW 14 32,831,476 (GRCm39) nonsense probably null
moro UTSW 14 32,686,583 (GRCm39) splice site probably null
popped UTSW 14 32,688,356 (GRCm39) missense probably damaging 0.99
sequoia UTSW 14 32,822,860 (GRCm39) critical splice donor site probably null
Sherman UTSW 14 32,817,908 (GRCm39) missense possibly damaging 0.89
stretched UTSW 14 32,795,492 (GRCm39) nonsense probably null
watchtower UTSW 14 32,805,596 (GRCm39) critical splice donor site probably null
R0014:Wdfy4 UTSW 14 32,829,130 (GRCm39) missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 32,884,708 (GRCm39) missense probably null 1.00
R0085:Wdfy4 UTSW 14 32,800,200 (GRCm39) missense possibly damaging 0.81
R0277:Wdfy4 UTSW 14 32,805,742 (GRCm39) missense possibly damaging 0.83
R0436:Wdfy4 UTSW 14 32,805,769 (GRCm39) splice site probably benign
R0496:Wdfy4 UTSW 14 32,862,695 (GRCm39) splice site probably benign
R0514:Wdfy4 UTSW 14 32,802,732 (GRCm39) missense probably benign 0.22
R0548:Wdfy4 UTSW 14 32,764,578 (GRCm39) missense probably benign
R0590:Wdfy4 UTSW 14 32,763,131 (GRCm39) missense probably benign 0.09
R0647:Wdfy4 UTSW 14 32,831,656 (GRCm39) missense possibly damaging 0.96
R0766:Wdfy4 UTSW 14 32,862,569 (GRCm39) missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 32,869,049 (GRCm39) missense probably benign 0.03
R1024:Wdfy4 UTSW 14 32,801,923 (GRCm39) missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32,693,695 (GRCm39) missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32,693,729 (GRCm39) splice site probably null
R1415:Wdfy4 UTSW 14 32,763,137 (GRCm39) missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 32,830,645 (GRCm39) missense probably benign 0.14
R1483:Wdfy4 UTSW 14 32,822,923 (GRCm39) missense probably benign 0.41
R1490:Wdfy4 UTSW 14 32,874,495 (GRCm39) critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32,682,765 (GRCm39) missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 32,764,469 (GRCm39) missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32,681,918 (GRCm39) missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 32,795,542 (GRCm39) critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 32,817,962 (GRCm39) missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 32,825,940 (GRCm39) missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 32,855,301 (GRCm39) missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32,693,641 (GRCm39) missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 32,828,001 (GRCm39) missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 32,868,946 (GRCm39) missense probably benign 0.11
R2241:Wdfy4 UTSW 14 32,795,468 (GRCm39) missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 32,884,764 (GRCm39) missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 32,831,476 (GRCm39) nonsense probably null
R2889:Wdfy4 UTSW 14 32,831,476 (GRCm39) nonsense probably null
R3114:Wdfy4 UTSW 14 32,811,860 (GRCm39) missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 32,745,331 (GRCm39) missense probably benign 0.17
R3758:Wdfy4 UTSW 14 32,745,331 (GRCm39) missense probably benign 0.17
R3797:Wdfy4 UTSW 14 32,862,602 (GRCm39) missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 32,769,237 (GRCm39) missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 32,769,237 (GRCm39) missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32,688,352 (GRCm39) missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 32,824,637 (GRCm39) splice site probably benign
R4091:Wdfy4 UTSW 14 32,847,837 (GRCm39) missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 32,818,040 (GRCm39) missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 32,809,912 (GRCm39) missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 32,824,515 (GRCm39) missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 32,824,515 (GRCm39) missense probably damaging 0.97
R4655:Wdfy4 UTSW 14 32,711,893 (GRCm39) missense probably damaging 0.98
R4689:Wdfy4 UTSW 14 32,831,505 (GRCm39) missense possibly damaging 0.88
R4718:Wdfy4 UTSW 14 32,867,273 (GRCm39) missense probably benign 0.03
R4862:Wdfy4 UTSW 14 32,822,860 (GRCm39) critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32,710,852 (GRCm39) nonsense probably null
R4894:Wdfy4 UTSW 14 32,877,717 (GRCm39) missense probably benign 0.03
R4929:Wdfy4 UTSW 14 32,769,213 (GRCm39) missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 32,750,970 (GRCm39) missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 32,822,897 (GRCm39) missense probably benign 0.02
R5020:Wdfy4 UTSW 14 32,801,892 (GRCm39) missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 32,874,627 (GRCm39) missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 32,769,232 (GRCm39) missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 32,800,300 (GRCm39) missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 32,812,823 (GRCm39) missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32,710,856 (GRCm39) missense probably damaging 1.00
R5411:Wdfy4 UTSW 14 32,681,959 (GRCm39) missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 32,742,268 (GRCm39) missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 32,873,689 (GRCm39) missense probably benign 0.17
R5591:Wdfy4 UTSW 14 32,829,087 (GRCm39) missense probably benign 0.09
R5598:Wdfy4 UTSW 14 32,855,454 (GRCm39) missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 32,829,575 (GRCm39) splice site probably null
R5890:Wdfy4 UTSW 14 32,824,534 (GRCm39) missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 32,855,317 (GRCm39) missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 32,827,968 (GRCm39) missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 32,868,947 (GRCm39) missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 32,868,947 (GRCm39) missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 32,805,596 (GRCm39) critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32,693,668 (GRCm39) missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 32,831,482 (GRCm39) missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 32,823,006 (GRCm39) nonsense probably null
R6370:Wdfy4 UTSW 14 32,790,807 (GRCm39) missense probably benign 0.16
R6390:Wdfy4 UTSW 14 32,826,051 (GRCm39) missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32,689,604 (GRCm39) missense probably damaging 1.00
R6450:Wdfy4 UTSW 14 32,830,649 (GRCm39) missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 32,868,901 (GRCm39) missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 32,769,208 (GRCm39) missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 32,817,908 (GRCm39) missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 32,764,469 (GRCm39) missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32,681,923 (GRCm39) missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 32,821,074 (GRCm39) missense possibly damaging 0.68
R7024:Wdfy4 UTSW 14 32,686,583 (GRCm39) splice site probably null
R7101:Wdfy4 UTSW 14 32,682,777 (GRCm39) missense
R7114:Wdfy4 UTSW 14 32,693,531 (GRCm39) splice site probably null
R7139:Wdfy4 UTSW 14 32,873,535 (GRCm39) missense
R7255:Wdfy4 UTSW 14 32,696,239 (GRCm39) missense
R7324:Wdfy4 UTSW 14 32,769,271 (GRCm39) missense
R7379:Wdfy4 UTSW 14 32,873,566 (GRCm39) missense
R7399:Wdfy4 UTSW 14 32,790,863 (GRCm39) missense
R7408:Wdfy4 UTSW 14 32,800,264 (GRCm39) missense
R7410:Wdfy4 UTSW 14 32,696,191 (GRCm39) missense
R7411:Wdfy4 UTSW 14 32,828,088 (GRCm39) missense
R7412:Wdfy4 UTSW 14 32,871,541 (GRCm39) missense
R7445:Wdfy4 UTSW 14 32,792,575 (GRCm39) nonsense probably null
R7595:Wdfy4 UTSW 14 32,696,111 (GRCm39) critical splice donor site probably null
R7618:Wdfy4 UTSW 14 32,707,696 (GRCm39) missense
R7622:Wdfy4 UTSW 14 32,800,231 (GRCm39) missense
R7828:Wdfy4 UTSW 14 32,710,878 (GRCm39) missense possibly damaging 0.90
R7888:Wdfy4 UTSW 14 32,812,920 (GRCm39) missense
R7946:Wdfy4 UTSW 14 32,792,705 (GRCm39) missense
R7946:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R7986:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R7990:Wdfy4 UTSW 14 32,819,752 (GRCm39) missense
R8001:Wdfy4 UTSW 14 32,695,492 (GRCm39) critical splice donor site probably null
R8010:Wdfy4 UTSW 14 32,693,584 (GRCm39) missense
R8015:Wdfy4 UTSW 14 32,829,704 (GRCm39) missense
R8032:Wdfy4 UTSW 14 32,751,043 (GRCm39) nonsense probably null
R8041:Wdfy4 UTSW 14 32,875,965 (GRCm39) critical splice donor site probably null
R8090:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8092:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8112:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8114:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8115:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8117:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8117:Wdfy4 UTSW 14 32,699,063 (GRCm39) nonsense probably null
R8118:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8140:Wdfy4 UTSW 14 32,864,317 (GRCm39) missense
R8155:Wdfy4 UTSW 14 32,884,776 (GRCm39) missense
R8163:Wdfy4 UTSW 14 32,873,545 (GRCm39) missense
R8293:Wdfy4 UTSW 14 32,696,218 (GRCm39) missense
R8325:Wdfy4 UTSW 14 32,689,444 (GRCm39) missense
R8353:Wdfy4 UTSW 14 32,695,581 (GRCm39) missense probably benign
R8370:Wdfy4 UTSW 14 32,815,208 (GRCm39) missense
R8437:Wdfy4 UTSW 14 32,798,332 (GRCm39) missense
R8497:Wdfy4 UTSW 14 32,688,356 (GRCm39) missense probably damaging 0.99
R8545:Wdfy4 UTSW 14 32,800,258 (GRCm39) missense probably benign 0.01
R8671:Wdfy4 UTSW 14 32,693,722 (GRCm39) splice site probably benign
R8747:Wdfy4 UTSW 14 32,874,611 (GRCm39) missense
R8794:Wdfy4 UTSW 14 32,869,049 (GRCm39) missense probably benign 0.03
R8846:Wdfy4 UTSW 14 32,867,105 (GRCm39) missense
R8880:Wdfy4 UTSW 14 32,795,492 (GRCm39) nonsense probably null
R9109:Wdfy4 UTSW 14 32,760,704 (GRCm39) splice site probably null
R9131:Wdfy4 UTSW 14 32,819,807 (GRCm39) missense
R9309:Wdfy4 UTSW 14 32,817,313 (GRCm39) missense
R9349:Wdfy4 UTSW 14 32,875,996 (GRCm39) missense
R9451:Wdfy4 UTSW 14 32,855,518 (GRCm39) missense
R9563:Wdfy4 UTSW 14 32,692,833 (GRCm39) missense
R9587:Wdfy4 UTSW 14 32,769,230 (GRCm39) nonsense probably null
R9599:Wdfy4 UTSW 14 32,855,428 (GRCm39) missense
R9670:Wdfy4 UTSW 14 32,769,219 (GRCm39) missense
R9718:Wdfy4 UTSW 14 32,847,893 (GRCm39) missense
R9742:Wdfy4 UTSW 14 32,809,987 (GRCm39) missense
X0028:Wdfy4 UTSW 14 32,802,593 (GRCm39) missense probably benign
X0053:Wdfy4 UTSW 14 32,884,899 (GRCm39) start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 32,829,575 (GRCm39) splice site probably null
Z1177:Wdfy4 UTSW 14 32,809,942 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ATGGTTGGCACACATAGGGTC -3'
(R):5'- AGGCAACCTATTAGTAGCCATACTG -3'

Sequencing Primer
(F):5'- GTTGGCACACATAGGGTCATATCC -3'
(R):5'- TAGTAGCCATACTGCAAGTCTC -3'
Posted On 2021-04-30