Incidental Mutation 'R8708:Dock5'
ID 669400
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms lr2, 1110060D06Rik, rlc
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R8708 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 67752135-67933442 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67767371 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1529 (V1529A)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect probably benign
Transcript: ENSMUST00000039135
AA Change: V1529A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: V1529A

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,561,480 K230R probably damaging Het
Akp3 T A 1: 87,126,369 Y236* probably null Het
Alg11 T C 8: 22,065,113 F130S probably damaging Het
Ankfn1 A T 11: 89,503,930 S276R possibly damaging Het
Ankhd1 T A 18: 36,594,291 H486Q probably damaging Het
Ankrd23 T C 1: 36,534,088 T68A probably benign Het
Arhgap23 A G 11: 97,452,412 T507A probably benign Het
Arid1a A T 4: 133,681,834 D1787E unknown Het
Atad2b T A 12: 4,961,253 D504E probably damaging Het
Atg2b T A 12: 105,669,428 probably benign Het
Bptf C A 11: 107,073,313 S1685I probably damaging Het
Bptf T A 11: 107,073,314 S1685C probably damaging Het
Cacna1c A T 6: 118,627,455 I1437N Het
Capn1 T C 19: 6,011,298 K197E probably damaging Het
Ccdc177 T C 12: 80,759,117 T128A probably benign Het
Ccdc7b G T 8: 129,136,614 M9I probably benign Het
Celf1 T A 2: 91,010,580 probably null Het
Ckap5 T A 2: 91,595,478 N1285K probably benign Het
Col24a1 C T 3: 145,545,265 T1673I probably damaging Het
Dbp A G 7: 45,709,801 E300G probably damaging Het
Dchs2 C A 3: 83,128,742 H265Q probably benign Het
Dicer1 A T 12: 104,728,445 S198T possibly damaging Het
Dnase1l2 A T 17: 24,442,292 F86L probably benign Het
Dnhd1 T G 7: 105,694,280 Y1610* probably null Het
Egfr G T 11: 16,867,300 probably benign Het
Exph5 T A 9: 53,375,796 H1392Q probably benign Het
Fam78b A G 1: 167,078,763 K164E possibly damaging Het
Fignl2 C A 15: 101,052,853 R516L unknown Het
Fndc7 C T 3: 108,867,212 E577K probably benign Het
Fryl T C 5: 73,132,562 E107G probably benign Het
Gbp10 A T 5: 105,220,965 M336K probably damaging Het
Gm11444 A T 11: 85,846,897 C156S Het
Gm6904 A T 14: 59,244,813 C164S probably damaging Het
Gm996 C A 2: 25,577,802 R699L possibly damaging Het
Golga3 C A 5: 110,202,855 A752E probably benign Het
Gper1 G T 5: 139,425,935 V12L probably benign Het
Hmbox1 G T 14: 64,823,640 A394E probably damaging Het
Ighv1-71 T A 12: 115,742,335 I77L probably benign Het
Ing4 A T 6: 125,047,932 N214Y probably damaging Het
Ints8 A G 4: 11,208,824 probably null Het
Itpa T A 2: 130,675,719 V129E probably damaging Het
Itpripl1 T A 2: 127,141,342 M287L probably benign Het
Klc3 T C 7: 19,395,859 I362V probably damaging Het
Ky T A 9: 102,525,391 probably benign Het
Lasp1 A G 11: 97,806,883 N43S possibly damaging Het
Limk2 A G 11: 3,350,763 M380T probably benign Het
Lrp2 T A 2: 69,459,613 E3627D probably damaging Het
Lrrc25 T C 8: 70,617,809 L80P probably damaging Het
Mcoln3 A T 3: 146,140,521 K529* probably null Het
Mdn1 A C 4: 32,725,854 D2591A probably damaging Het
Med12l A G 3: 59,252,330 I1267V probably benign Het
Mei4 C A 9: 81,927,542 S226* probably null Het
Mios G A 6: 8,234,255 V809M probably benign Het
Mmp17 G A 5: 129,595,422 R146Q possibly damaging Het
Mob3a G A 10: 80,691,384 Q36* probably null Het
Myo3a T A 2: 22,291,796 probably benign Het
Naca A T 10: 128,048,074 I2125F probably damaging Het
Ndst3 A C 3: 123,528,915 S840A probably benign Het
Nlrp4c T C 7: 6,065,604 M168T probably damaging Het
Nt5c3 A G 6: 56,897,773 probably null Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr1489 T C 19: 13,634,037 S309P probably benign Het
Olfr366 T A 2: 37,219,944 S152T probably damaging Het
Olfr774 T A 10: 129,238,809 I220N possibly damaging Het
Pcgf3 A G 5: 108,486,197 D107G probably benign Het
Pde2a A G 7: 101,510,381 D816G probably damaging Het
Phf10 T A 17: 14,955,999 T131S possibly damaging Het
Phrf1 A G 7: 141,232,533 D70G unknown Het
Piezo2 A G 18: 63,093,015 L850S probably damaging Het
Plcg1 T A 2: 160,754,553 probably benign Het
Plekhh2 A T 17: 84,574,993 I676L probably benign Het
Ppp1r9a T G 6: 5,115,196 V804G probably damaging Het
Ppt2 T C 17: 34,625,639 H180R possibly damaging Het
Prdm15 T C 16: 97,816,866 H398R unknown Het
Rab26 A T 17: 24,529,798 M208K probably damaging Het
Rab31 A C 17: 65,667,864 probably benign Het
Radil A G 5: 142,485,449 V1024A probably damaging Het
Rorb A G 19: 18,983,416 I65T probably damaging Het
Sall1 A T 8: 89,032,855 V207E probably damaging Het
Sart3 A T 5: 113,744,667 M864K possibly damaging Het
Sdcbp2 T A 2: 151,589,537 S277T probably benign Het
Sept5 A G 16: 18,624,872 V100A probably benign Het
Sipa1 C T 19: 5,660,952 R10Q probably damaging Het
Ski A T 4: 155,160,662 S376T probably damaging Het
Slc15a4 A T 5: 127,596,651 D566E probably benign Het
Srgap2 G A 1: 131,345,806 Q372* probably null Het
Stard9 A G 2: 120,703,578 T3439A probably damaging Het
Tln1 T C 4: 43,534,769 probably benign Het
Tmco3 A G 8: 13,295,998 M279V probably benign Het
Tmem39b T C 4: 129,676,398 probably benign Het
Trio T A 15: 27,732,546 N3083I probably damaging Het
Ube3b G A 5: 114,393,090 R215Q probably benign Het
Ubr1 T C 2: 120,866,483 N1646S probably benign Het
Uqcrc1 T G 9: 108,947,040 F270C probably damaging Het
Vmn2r108 T A 17: 20,462,425 N839I probably damaging Het
Vmn2r75 A T 7: 86,163,268 S514R probably damaging Het
Wdfy4 C G 14: 32,967,532 V3016L Het
Wdr11 A G 7: 129,599,056 N77S probably benign Het
Wdr17 C A 8: 54,640,092 probably benign Het
Wrn T A 8: 33,292,643 N753I probably damaging Het
Zan A G 5: 137,463,277 probably null Het
Zfat T A 15: 68,084,429 T1203S possibly damaging Het
Zfhx2 A C 14: 55,075,052 S62A probably benign Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8076:Dock5 UTSW 14 67802977 splice site probably null
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8353:Dock5 UTSW 14 67817508 splice site probably null
R8480:Dock5 UTSW 14 67836410 missense probably benign 0.32
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8732:Dock5 UTSW 14 67846000 missense possibly damaging 0.85
R8888:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67845990 nonsense probably null
R8962:Dock5 UTSW 14 67757191 missense probably benign
R8972:Dock5 UTSW 14 67776300 missense probably damaging 1.00
R9244:Dock5 UTSW 14 67759114 missense probably damaging 0.99
R9345:Dock5 UTSW 14 67822622 missense possibly damaging 0.74
R9679:Dock5 UTSW 14 67781001 missense probably damaging 1.00
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAGGGACAATCCTCGTGTAATTC -3'
(R):5'- ACAAGTGAACACTCCTGCAG -3'

Sequencing Primer
(F):5'- ATTCCACATGGCCATTTGGAGAG -3'
(R):5'- TGAACACTCCTGCAGACTGTGAG -3'
Posted On 2021-04-30