Incidental Mutation 'R8708:Dock5'
ID 669400
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms 1110060D06Rik, rlc, lr2
MMRRC Submission 068562-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.346) question?
Stock # R8708 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 67989584-68170891 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68004820 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1529 (V1529A)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect probably benign
Transcript: ENSMUST00000039135
AA Change: V1529A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: V1529A

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,403,400 (GRCm39) K230R probably damaging Het
Ajm1 C A 2: 25,467,814 (GRCm39) R699L possibly damaging Het
Akp3 T A 1: 87,054,091 (GRCm39) Y236* probably null Het
Alg11 T C 8: 22,555,129 (GRCm39) F130S probably damaging Het
Ankfn1 A T 11: 89,394,756 (GRCm39) S276R possibly damaging Het
Ankhd1 T A 18: 36,727,344 (GRCm39) H486Q probably damaging Het
Ankrd23 T C 1: 36,573,169 (GRCm39) T68A probably benign Het
Arhgap23 A G 11: 97,343,238 (GRCm39) T507A probably benign Het
Arid1a A T 4: 133,409,145 (GRCm39) D1787E unknown Het
Atad2b T A 12: 5,011,253 (GRCm39) D504E probably damaging Het
Atg2b T A 12: 105,635,687 (GRCm39) probably benign Het
Bptf C A 11: 106,964,139 (GRCm39) S1685I probably damaging Het
Bptf T A 11: 106,964,140 (GRCm39) S1685C probably damaging Het
Cacna1c A T 6: 118,604,416 (GRCm39) I1437N Het
Capn1 T C 19: 6,061,328 (GRCm39) K197E probably damaging Het
Ccdc177 T C 12: 80,805,891 (GRCm39) T128A probably benign Het
Ccdc7b G T 8: 129,863,095 (GRCm39) M9I probably benign Het
Celf1 T A 2: 90,840,925 (GRCm39) probably null Het
Ckap5 T A 2: 91,425,823 (GRCm39) N1285K probably benign Het
Col24a1 C T 3: 145,251,020 (GRCm39) T1673I probably damaging Het
Dbp A G 7: 45,359,225 (GRCm39) E300G probably damaging Het
Dchs2 C A 3: 83,036,049 (GRCm39) H265Q probably benign Het
Dicer1 A T 12: 104,694,704 (GRCm39) S198T possibly damaging Het
Dnase1l2 A T 17: 24,661,266 (GRCm39) F86L probably benign Het
Dnhd1 T G 7: 105,343,487 (GRCm39) Y1610* probably null Het
Egfr G T 11: 16,817,300 (GRCm39) probably benign Het
Exph5 T A 9: 53,287,096 (GRCm39) H1392Q probably benign Het
Fam78b A G 1: 166,906,332 (GRCm39) K164E possibly damaging Het
Fignl2 C A 15: 100,950,734 (GRCm39) R516L unknown Het
Fndc7 C T 3: 108,774,528 (GRCm39) E577K probably benign Het
Fryl T C 5: 73,289,905 (GRCm39) E107G probably benign Het
Gbp10 A T 5: 105,368,831 (GRCm39) M336K probably damaging Het
Gm11444 A T 11: 85,737,723 (GRCm39) C156S Het
Golga3 C A 5: 110,350,721 (GRCm39) A752E probably benign Het
Gper1 G T 5: 139,411,690 (GRCm39) V12L probably benign Het
Hmbox1 G T 14: 65,061,089 (GRCm39) A394E probably damaging Het
Ighv1-71 T A 12: 115,705,955 (GRCm39) I77L probably benign Het
Ing4 A T 6: 125,024,895 (GRCm39) N214Y probably damaging Het
Ints8 A G 4: 11,208,824 (GRCm39) probably null Het
Itpa T A 2: 130,517,639 (GRCm39) V129E probably damaging Het
Itpripl1 T A 2: 126,983,262 (GRCm39) M287L probably benign Het
Klc3 T C 7: 19,129,784 (GRCm39) I362V probably damaging Het
Ky T A 9: 102,402,590 (GRCm39) probably benign Het
Lasp1 A G 11: 97,697,709 (GRCm39) N43S possibly damaging Het
Limk2 A G 11: 3,300,763 (GRCm39) M380T probably benign Het
Lrp2 T A 2: 69,289,957 (GRCm39) E3627D probably damaging Het
Lrrc25 T C 8: 71,070,459 (GRCm39) L80P probably damaging Het
Mcoln3 A T 3: 145,846,276 (GRCm39) K529* probably null Het
Mdn1 A C 4: 32,725,854 (GRCm39) D2591A probably damaging Het
Med12l A G 3: 59,159,751 (GRCm39) I1267V probably benign Het
Mei4 C A 9: 81,809,595 (GRCm39) S226* probably null Het
Mios G A 6: 8,234,255 (GRCm39) V809M probably benign Het
Mmp17 G A 5: 129,672,486 (GRCm39) R146Q possibly damaging Het
Mob3a G A 10: 80,527,218 (GRCm39) Q36* probably null Het
Myo3a T A 2: 22,296,607 (GRCm39) probably benign Het
Naca A T 10: 127,883,943 (GRCm39) I2125F probably damaging Het
Ndst3 A C 3: 123,322,564 (GRCm39) S840A probably benign Het
Nlrp4c T C 7: 6,068,603 (GRCm39) M168T probably damaging Het
Nt5c3 A G 6: 56,874,758 (GRCm39) probably null Het
Or1af1 T A 2: 37,109,956 (GRCm39) S152T probably damaging Het
Or4a72 C A 2: 89,405,623 (GRCm39) G149V probably damaging Het
Or5b124 T C 19: 13,611,401 (GRCm39) S309P probably benign Het
Or6c5 T A 10: 129,074,678 (GRCm39) I220N possibly damaging Het
Pcgf3 A G 5: 108,634,063 (GRCm39) D107G probably benign Het
Pde2a A G 7: 101,159,588 (GRCm39) D816G probably damaging Het
Phf10 T A 17: 15,176,261 (GRCm39) T131S possibly damaging Het
Phf11 A T 14: 59,482,262 (GRCm39) C164S probably damaging Het
Phrf1 A G 7: 140,812,446 (GRCm39) D70G unknown Het
Piezo2 A G 18: 63,226,086 (GRCm39) L850S probably damaging Het
Plcg1 T A 2: 160,596,473 (GRCm39) probably benign Het
Plekhh2 A T 17: 84,882,421 (GRCm39) I676L probably benign Het
Ppp1r9a T G 6: 5,115,196 (GRCm39) V804G probably damaging Het
Ppt2 T C 17: 34,844,613 (GRCm39) H180R possibly damaging Het
Prdm15 T C 16: 97,618,066 (GRCm39) H398R unknown Het
Rab26 A T 17: 24,748,772 (GRCm39) M208K probably damaging Het
Rab31 A C 17: 65,974,859 (GRCm39) probably benign Het
Radil A G 5: 142,471,204 (GRCm39) V1024A probably damaging Het
Rorb A G 19: 18,960,780 (GRCm39) I65T probably damaging Het
Sall1 A T 8: 89,759,483 (GRCm39) V207E probably damaging Het
Sart3 A T 5: 113,882,728 (GRCm39) M864K possibly damaging Het
Sdcbp2 T A 2: 151,431,457 (GRCm39) S277T probably benign Het
Septin5 A G 16: 18,443,622 (GRCm39) V100A probably benign Het
Sipa1 C T 19: 5,710,980 (GRCm39) R10Q probably damaging Het
Ski A T 4: 155,245,119 (GRCm39) S376T probably damaging Het
Slc15a4 A T 5: 127,673,715 (GRCm39) D566E probably benign Het
Srgap2 G A 1: 131,273,544 (GRCm39) Q372* probably null Het
Stard9 A G 2: 120,534,059 (GRCm39) T3439A probably damaging Het
Tln1 T C 4: 43,534,769 (GRCm39) probably benign Het
Tmco3 A G 8: 13,345,998 (GRCm39) M279V probably benign Het
Tmem39b T C 4: 129,570,191 (GRCm39) probably benign Het
Trio T A 15: 27,732,632 (GRCm39) N3083I probably damaging Het
Ube3b G A 5: 114,531,151 (GRCm39) R215Q probably benign Het
Ubr1 T C 2: 120,696,964 (GRCm39) N1646S probably benign Het
Uqcrc1 T G 9: 108,776,108 (GRCm39) F270C probably damaging Het
Vmn2r108 T A 17: 20,682,687 (GRCm39) N839I probably damaging Het
Vmn2r75 A T 7: 85,812,476 (GRCm39) S514R probably damaging Het
Wdfy4 C G 14: 32,689,489 (GRCm39) V3016L Het
Wdr11 A G 7: 129,200,780 (GRCm39) N77S probably benign Het
Wdr17 C A 8: 55,093,127 (GRCm39) probably benign Het
Wrn T A 8: 33,782,671 (GRCm39) N753I probably damaging Het
Zan A G 5: 137,461,539 (GRCm39) probably null Het
Zfat T A 15: 67,956,278 (GRCm39) T1203S possibly damaging Het
Zfhx2 A C 14: 55,312,509 (GRCm39) S62A probably benign Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 68,024,338 (GRCm39) splice site probably benign
IGL00930:Dock5 APN 14 68,008,526 (GRCm39) missense probably damaging 1.00
IGL01525:Dock5 APN 14 68,043,169 (GRCm39) splice site probably benign
IGL01759:Dock5 APN 14 68,118,708 (GRCm39) nonsense probably null
IGL01941:Dock5 APN 14 68,049,681 (GRCm39) missense probably damaging 1.00
IGL02025:Dock5 APN 14 68,000,736 (GRCm39) missense probably damaging 1.00
IGL02093:Dock5 APN 14 68,076,992 (GRCm39) splice site probably benign
IGL02179:Dock5 APN 14 68,043,945 (GRCm39) splice site probably benign
IGL02208:Dock5 APN 14 68,065,899 (GRCm39) missense probably benign 0.06
IGL02605:Dock5 APN 14 68,065,887 (GRCm39) missense probably benign 0.18
IGL02608:Dock5 APN 14 68,065,888 (GRCm39) missense probably benign 0.01
IGL02938:Dock5 APN 14 67,994,667 (GRCm39) splice site probably benign
IGL02971:Dock5 APN 14 67,994,558 (GRCm39) missense probably null 1.00
IGL02983:Dock5 APN 14 68,002,119 (GRCm39) missense probably damaging 1.00
IGL03151:Dock5 APN 14 68,103,516 (GRCm39) missense probably damaging 1.00
IGL03410:Dock5 APN 14 68,083,535 (GRCm39) missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 68,062,123 (GRCm39) missense possibly damaging 0.83
R0026:Dock5 UTSW 14 68,083,530 (GRCm39) missense probably benign 0.00
R0058:Dock5 UTSW 14 68,018,485 (GRCm39) missense probably benign 0.00
R0058:Dock5 UTSW 14 68,018,485 (GRCm39) missense probably benign 0.00
R0112:Dock5 UTSW 14 68,057,090 (GRCm39) missense probably benign
R0127:Dock5 UTSW 14 68,083,491 (GRCm39) missense probably benign 0.13
R0144:Dock5 UTSW 14 68,023,735 (GRCm39) missense probably benign 0.18
R0312:Dock5 UTSW 14 68,033,440 (GRCm39) missense possibly damaging 0.82
R0360:Dock5 UTSW 14 68,060,129 (GRCm39) splice site probably benign
R0364:Dock5 UTSW 14 68,060,129 (GRCm39) splice site probably benign
R0496:Dock5 UTSW 14 68,054,967 (GRCm39) missense probably damaging 1.00
R0506:Dock5 UTSW 14 68,022,241 (GRCm39) splice site probably benign
R0586:Dock5 UTSW 14 68,046,481 (GRCm39) missense probably damaging 1.00
R0597:Dock5 UTSW 14 68,022,383 (GRCm39) splice site probably null
R0625:Dock5 UTSW 14 68,078,612 (GRCm39) missense probably benign
R1109:Dock5 UTSW 14 68,043,927 (GRCm39) missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67,996,610 (GRCm39) missense probably benign 0.00
R1278:Dock5 UTSW 14 68,077,015 (GRCm39) missense possibly damaging 0.80
R1927:Dock5 UTSW 14 68,083,511 (GRCm39) missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67,994,584 (GRCm39) nonsense probably null
R1946:Dock5 UTSW 14 68,023,765 (GRCm39) missense probably damaging 1.00
R2046:Dock5 UTSW 14 68,049,591 (GRCm39) missense probably benign
R2101:Dock5 UTSW 14 68,031,459 (GRCm39) missense probably benign 0.02
R2252:Dock5 UTSW 14 68,022,261 (GRCm39) missense probably damaging 0.98
R2882:Dock5 UTSW 14 68,077,069 (GRCm39) missense probably damaging 0.99
R3110:Dock5 UTSW 14 68,095,371 (GRCm39) missense possibly damaging 0.72
R3112:Dock5 UTSW 14 68,095,371 (GRCm39) missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67,993,941 (GRCm39) missense probably benign 0.02
R4242:Dock5 UTSW 14 68,065,939 (GRCm39) missense probably benign 0.19
R4244:Dock5 UTSW 14 68,012,031 (GRCm39) missense probably benign 0.41
R4646:Dock5 UTSW 14 68,080,228 (GRCm39) missense probably benign 0.01
R4793:Dock5 UTSW 14 68,037,803 (GRCm39) missense probably benign 0.26
R4841:Dock5 UTSW 14 68,055,012 (GRCm39) missense probably damaging 0.98
R4842:Dock5 UTSW 14 68,055,012 (GRCm39) missense probably damaging 0.98
R5159:Dock5 UTSW 14 68,029,738 (GRCm39) missense probably benign 0.04
R5164:Dock5 UTSW 14 68,055,110 (GRCm39) nonsense probably null
R5206:Dock5 UTSW 14 68,000,633 (GRCm39) missense probably benign 0.35
R5207:Dock5 UTSW 14 68,013,733 (GRCm39) missense probably benign 0.06
R5322:Dock5 UTSW 14 68,007,715 (GRCm39) missense probably benign 0.41
R5374:Dock5 UTSW 14 68,043,205 (GRCm39) missense possibly damaging 0.81
R5413:Dock5 UTSW 14 68,002,104 (GRCm39) missense probably damaging 1.00
R5476:Dock5 UTSW 14 68,051,456 (GRCm39) missense possibly damaging 0.92
R5504:Dock5 UTSW 14 68,040,535 (GRCm39) missense probably benign 0.01
R5677:Dock5 UTSW 14 68,015,052 (GRCm39) missense probably benign 0.00
R5773:Dock5 UTSW 14 68,033,507 (GRCm39) missense possibly damaging 0.95
R5845:Dock5 UTSW 14 68,078,550 (GRCm39) missense possibly damaging 0.82
R5957:Dock5 UTSW 14 68,095,443 (GRCm39) missense probably benign
R6154:Dock5 UTSW 14 68,097,361 (GRCm39) missense probably benign 0.03
R6268:Dock5 UTSW 14 68,027,724 (GRCm39) nonsense probably null
R6393:Dock5 UTSW 14 68,060,051 (GRCm39) missense probably benign 0.32
R6512:Dock5 UTSW 14 68,062,097 (GRCm39) missense possibly damaging 0.93
R6759:Dock5 UTSW 14 68,033,445 (GRCm39) missense probably benign 0.00
R7012:Dock5 UTSW 14 68,060,035 (GRCm39) missense probably damaging 1.00
R7061:Dock5 UTSW 14 68,007,703 (GRCm39) missense probably damaging 0.96
R7196:Dock5 UTSW 14 67,993,919 (GRCm39) missense probably damaging 1.00
R7200:Dock5 UTSW 14 68,009,151 (GRCm39) nonsense probably null
R7311:Dock5 UTSW 14 68,065,951 (GRCm39) missense probably benign 0.25
R7359:Dock5 UTSW 14 68,003,337 (GRCm39) missense probably benign 0.10
R7422:Dock5 UTSW 14 68,046,479 (GRCm39) missense probably benign 0.01
R7588:Dock5 UTSW 14 68,000,607 (GRCm39) critical splice donor site probably null
R7637:Dock5 UTSW 14 68,023,789 (GRCm39) missense possibly damaging 0.95
R7709:Dock5 UTSW 14 68,033,454 (GRCm39) missense probably benign 0.44
R7763:Dock5 UTSW 14 68,058,776 (GRCm39) missense probably damaging 0.97
R8044:Dock5 UTSW 14 68,062,141 (GRCm39) missense probably damaging 1.00
R8076:Dock5 UTSW 14 68,040,426 (GRCm39) splice site probably null
R8168:Dock5 UTSW 14 68,007,646 (GRCm39) splice site probably null
R8353:Dock5 UTSW 14 68,054,957 (GRCm39) splice site probably null
R8480:Dock5 UTSW 14 68,073,859 (GRCm39) missense probably benign 0.32
R8535:Dock5 UTSW 14 68,031,425 (GRCm39) missense probably benign 0.19
R8732:Dock5 UTSW 14 68,083,449 (GRCm39) missense possibly damaging 0.85
R8888:Dock5 UTSW 14 68,055,112 (GRCm39) missense possibly damaging 0.95
R8895:Dock5 UTSW 14 68,055,112 (GRCm39) missense possibly damaging 0.95
R8936:Dock5 UTSW 14 68,083,439 (GRCm39) nonsense probably null
R8962:Dock5 UTSW 14 67,994,640 (GRCm39) missense probably benign
R8972:Dock5 UTSW 14 68,013,749 (GRCm39) missense probably damaging 1.00
R9244:Dock5 UTSW 14 67,996,563 (GRCm39) missense probably damaging 0.99
R9345:Dock5 UTSW 14 68,060,071 (GRCm39) missense possibly damaging 0.74
R9679:Dock5 UTSW 14 68,018,450 (GRCm39) missense probably damaging 1.00
X0023:Dock5 UTSW 14 68,008,537 (GRCm39) missense probably benign 0.15
Z1177:Dock5 UTSW 14 68,051,382 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAGGGACAATCCTCGTGTAATTC -3'
(R):5'- ACAAGTGAACACTCCTGCAG -3'

Sequencing Primer
(F):5'- ATTCCACATGGCCATTTGGAGAG -3'
(R):5'- TGAACACTCCTGCAGACTGTGAG -3'
Posted On 2021-04-30