Incidental Mutation 'R8708:Rorb'
ID669418
Institutional Source Beutler Lab
Gene Symbol Rorb
Ensembl Gene ENSMUSG00000036192
Gene NameRAR-related orphan receptor beta
SynonymsNr1f2, Rorbeta, RZR-beta
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8708 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location18930605-19111196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18983416 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 65 (I65T)
Ref Sequence ENSEMBL: ENSMUSP00000047597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040153] [ENSMUST00000112828] [ENSMUST00000112832]
Predicted Effect probably damaging
Transcript: ENSMUST00000040153
AA Change: I65T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047597
Gene: ENSMUSG00000036192
AA Change: I65T

DomainStartEndE-ValueType
ZnF_C4 18 89 1.51e-39 SMART
coiled coil region 95 133 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
HOLI 275 431 1.83e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112828
SMART Domains Protein: ENSMUSP00000108447
Gene: ENSMUSG00000036192

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
HOLI 190 346 1.83e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112832
AA Change: I54T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108451
Gene: ENSMUSG00000036192
AA Change: I54T

DomainStartEndE-ValueType
ZnF_C4 7 78 1.51e-39 SMART
coiled coil region 84 122 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
HOLI 264 420 1.83e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It is a DNA-binding protein that can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, and to help regulate the expression of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have impaired vision and a variety of behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,561,480 K230R probably damaging Het
Akp3 T A 1: 87,126,369 Y236* probably null Het
Alg11 T C 8: 22,065,113 F130S probably damaging Het
Ankfn1 A T 11: 89,503,930 S276R possibly damaging Het
Ankhd1 T A 18: 36,594,291 H486Q probably damaging Het
Ankrd23 T C 1: 36,534,088 T68A probably benign Het
Arhgap23 A G 11: 97,452,412 T507A probably benign Het
Arid1a A T 4: 133,681,834 D1787E unknown Het
Atad2b T A 12: 4,961,253 D504E probably damaging Het
Atg2b T A 12: 105,669,428 probably benign Het
Bptf C A 11: 107,073,313 S1685I probably damaging Het
Bptf T A 11: 107,073,314 S1685C probably damaging Het
Cacna1c A T 6: 118,627,455 I1437N Het
Capn1 T C 19: 6,011,298 K197E probably damaging Het
Ccdc177 T C 12: 80,759,117 T128A probably benign Het
Ccdc7b G T 8: 129,136,614 M9I probably benign Het
Celf1 T A 2: 91,010,580 probably null Het
Ckap5 T A 2: 91,595,478 N1285K probably benign Het
Col24a1 C T 3: 145,545,265 T1673I probably damaging Het
Dbp A G 7: 45,709,801 E300G probably damaging Het
Dchs2 C A 3: 83,128,742 H265Q probably benign Het
Dicer1 A T 12: 104,728,445 S198T possibly damaging Het
Dnase1l2 A T 17: 24,442,292 F86L probably benign Het
Dnhd1 T G 7: 105,694,280 Y1610* probably null Het
Dock5 A G 14: 67,767,371 V1529A probably benign Het
Egfr G T 11: 16,867,300 probably benign Het
Exph5 T A 9: 53,375,796 H1392Q probably benign Het
Fam78b A G 1: 167,078,763 K164E possibly damaging Het
Fignl2 C A 15: 101,052,853 R516L unknown Het
Fndc7 C T 3: 108,867,212 E577K probably benign Het
Fryl T C 5: 73,132,562 E107G probably benign Het
Gbp10 A T 5: 105,220,965 M336K probably damaging Het
Gm11444 A T 11: 85,846,897 C156S Het
Gm6904 A T 14: 59,244,813 C164S probably damaging Het
Gm996 C A 2: 25,577,802 R699L possibly damaging Het
Golga3 C A 5: 110,202,855 A752E probably benign Het
Gper1 G T 5: 139,425,935 V12L probably benign Het
Hmbox1 G T 14: 64,823,640 A394E probably damaging Het
Ighv1-71 T A 12: 115,742,335 I77L probably benign Het
Ing4 A T 6: 125,047,932 N214Y probably damaging Het
Ints8 A G 4: 11,208,824 probably null Het
Itpa T A 2: 130,675,719 V129E probably damaging Het
Itpripl1 T A 2: 127,141,342 M287L probably benign Het
Klc3 T C 7: 19,395,859 I362V probably damaging Het
Lasp1 A G 11: 97,806,883 N43S possibly damaging Het
Limk2 A G 11: 3,350,763 M380T probably benign Het
Lrp2 T A 2: 69,459,613 E3627D probably damaging Het
Lrrc25 T C 8: 70,617,809 L80P probably damaging Het
Mcoln3 A T 3: 146,140,521 K529* probably null Het
Mdn1 A C 4: 32,725,854 D2591A probably damaging Het
Med12l A G 3: 59,252,330 I1267V probably benign Het
Mei4 C A 9: 81,927,542 S226* probably null Het
Mios G A 6: 8,234,255 V809M probably benign Het
Mmp17 G A 5: 129,595,422 R146Q possibly damaging Het
Mob3a G A 10: 80,691,384 Q36* probably null Het
Naca A T 10: 128,048,074 I2125F probably damaging Het
Ndst3 A C 3: 123,528,915 S840A probably benign Het
Nlrp4c T C 7: 6,065,604 M168T probably damaging Het
Nt5c3 A G 6: 56,897,773 probably null Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr1489 T C 19: 13,634,037 S309P probably benign Het
Olfr366 T A 2: 37,219,944 S152T probably damaging Het
Olfr774 T A 10: 129,238,809 I220N possibly damaging Het
Pcgf3 A G 5: 108,486,197 D107G probably benign Het
Pde2a A G 7: 101,510,381 D816G probably damaging Het
Phf10 T A 17: 14,955,999 T131S possibly damaging Het
Phrf1 A G 7: 141,232,533 D70G unknown Het
Piezo2 A G 18: 63,093,015 L850S probably damaging Het
Plekhh2 A T 17: 84,574,993 I676L probably benign Het
Ppp1r9a T G 6: 5,115,196 V804G probably damaging Het
Ppt2 T C 17: 34,625,639 H180R possibly damaging Het
Prdm15 T C 16: 97,816,866 H398R unknown Het
Rab26 A T 17: 24,529,798 M208K probably damaging Het
Rab31 A C 17: 65,667,864 probably benign Het
Radil A G 5: 142,485,449 V1024A probably damaging Het
Sall1 A T 8: 89,032,855 V207E probably damaging Het
Sart3 A T 5: 113,744,667 M864K possibly damaging Het
Sdcbp2 T A 2: 151,589,537 S277T probably benign Het
Sept5 A G 16: 18,624,872 V100A probably benign Het
Sipa1 C T 19: 5,660,952 R10Q probably damaging Het
Ski A T 4: 155,160,662 S376T probably damaging Het
Slc15a4 A T 5: 127,596,651 D566E probably benign Het
Srgap2 G A 1: 131,345,806 Q372* probably null Het
Stard9 A G 2: 120,703,578 T3439A probably damaging Het
Tmco3 A G 8: 13,295,998 M279V probably benign Het
Trio T A 15: 27,732,546 N3083I probably damaging Het
Ube3b G A 5: 114,393,090 R215Q probably benign Het
Ubr1 T C 2: 120,866,483 N1646S probably benign Het
Uqcrc1 T G 9: 108,947,040 F270C probably damaging Het
Vmn2r108 T A 17: 20,462,425 N839I probably damaging Het
Vmn2r75 A T 7: 86,163,268 S514R probably damaging Het
Wdfy4 C G 14: 32,967,532 V3016L Het
Wdr11 A G 7: 129,599,056 N77S probably benign Het
Wrn T A 8: 33,292,643 N753I probably damaging Het
Zan A G 5: 137,463,277 probably null Het
Zfat T A 15: 68,084,429 T1203S possibly damaging Het
Zfhx2 A C 14: 55,075,052 S62A probably benign Het
Other mutations in Rorb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rorb APN 19 18957328 nonsense probably null
IGL01576:Rorb APN 19 18957334 missense probably damaging 1.00
IGL02863:Rorb APN 19 18952253 missense probably benign 0.05
IGL02886:Rorb APN 19 18977579 critical splice donor site probably null
4-limb_clasper UTSW 19 18983351 missense probably damaging 1.00
dee-no UTSW 19 18955053 missense probably damaging 1.00
grasshopper UTSW 19 19110557 start codon destroyed probably null 0.45
IGL02988:Rorb UTSW 19 18937972 missense probably damaging 1.00
R0748:Rorb UTSW 19 18977800 missense probably damaging 0.97
R1087:Rorb UTSW 19 18960414 missense probably damaging 1.00
R1438:Rorb UTSW 19 18955053 missense probably damaging 1.00
R1710:Rorb UTSW 19 18960501 missense probably damaging 1.00
R1846:Rorb UTSW 19 18955081 missense probably damaging 1.00
R1852:Rorb UTSW 19 18962083 missense probably damaging 1.00
R1972:Rorb UTSW 19 18952203 missense probably damaging 0.96
R3903:Rorb UTSW 19 18962099 missense probably damaging 0.99
R3978:Rorb UTSW 19 18937890 missense probably benign 0.00
R4497:Rorb UTSW 19 18977628 missense possibly damaging 0.95
R4982:Rorb UTSW 19 18977688 missense probably benign 0.05
R5602:Rorb UTSW 19 18977937 missense probably damaging 0.97
R5733:Rorb UTSW 19 18988107 missense probably damaging 1.00
R6267:Rorb UTSW 19 18977857 missense possibly damaging 0.88
R6455:Rorb UTSW 19 18960492 missense probably damaging 1.00
R6544:Rorb UTSW 19 18952250 missense possibly damaging 0.66
R6753:Rorb UTSW 19 18957247 missense probably benign 0.02
R7817:Rorb UTSW 19 18988096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCACGACCAGTCCTCTG -3'
(R):5'- AGAAGCCCTCTAAGAAGCATTAG -3'

Sequencing Primer
(F):5'- TCTTTATATCCCCAATTCCCACCG -3'
(R):5'- GCCCTCTAAGAAGCATTAGGAAAC -3'
Posted On2021-04-30