Incidental Mutation 'R8709:Polr1a'
ID669431
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Namepolymerase (RNA) I polypeptide A
SynonymsRPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8709 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location71909053-71984935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71974848 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1466 (D1466E)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296]
Predicted Effect probably benign
Transcript: ENSMUST00000055296
AA Change: D1466E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: D1466E

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik A G 4: 124,610,523 S79P unknown Het
Adamts20 T A 15: 94,341,066 D757V probably damaging Het
Adamts9 C T 6: 92,807,163 G1570D probably damaging Het
Adamtsl3 A G 7: 82,428,434 Y109C possibly damaging Het
Agl G A 3: 116,772,472 R335C Het
Ankfy1 C A 11: 72,755,706 T805K possibly damaging Het
Cast A T 13: 74,744,661 V96E probably damaging Het
Cdh17 G T 4: 11,795,685 E422* probably null Het
Cox4i1 T A 8: 120,669,371 L21H possibly damaging Het
Cwc22 T C 2: 77,896,350 E795G probably benign Het
Cwf19l2 C A 9: 3,430,723 Q352K probably benign Het
Cyp2d9 T C 15: 82,455,075 V226A probably benign Het
Dnah12 A G 14: 26,693,602 I53V probably benign Het
Dnah7a T C 1: 53,635,317 I434V probably benign Het
Dock8 C T 19: 25,078,084 Q137* probably null Het
Eif4b T G 15: 102,093,681 V515G unknown Het
Far2 T A 6: 148,165,635 N339K probably benign Het
Gm13124 C G 4: 144,555,293 A310P probably damaging Het
Gm16486 T C 8: 70,709,723 C522R possibly damaging Het
Gpr22 T C 12: 31,709,830 T98A probably damaging Het
Hamp2 A G 7: 30,922,549 C72R probably damaging Het
Hmgn1 G A 16: 96,127,340 P16S possibly damaging Het
Hspd1 A G 1: 55,081,763 S256P probably benign Het
Iqgap2 T C 13: 95,660,205 H1147R probably damaging Het
Klhl29 A T 12: 5,090,681 W654R probably damaging Het
Krtap22-2 T A 16: 89,010,626 Y28F unknown Het
Lcp2 T A 11: 34,054,354 probably benign Het
Muc5ac T G 7: 141,816,926 L3225R possibly damaging Het
Myom3 A G 4: 135,796,296 E908G possibly damaging Het
Olfr1247 C T 2: 89,610,022 V27I probably benign Het
Olfr290 T A 7: 84,916,463 I228N probably damaging Het
Olfr59 T A 11: 74,289,228 I194N possibly damaging Het
Olfr609 T C 7: 103,492,312 T189A probably benign Het
Pak4 A C 7: 28,562,544 D453E probably benign Het
Pkd1l1 T C 11: 8,855,567 T2120A Het
Pkhd1l1 T A 15: 44,518,174 S1099T probably benign Het
Pld2 C T 11: 70,553,449 R524W probably damaging Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rp1l1 A C 14: 64,031,846 D1627A probably damaging Het
Sephs1 T C 2: 4,884,591 V60A probably benign Het
Sipa1 C T 19: 5,660,952 R10Q probably damaging Het
Sp4 T C 12: 118,299,454 T286A possibly damaging Het
Spag5 T A 11: 78,301,912 S23R probably benign Het
Spag9 T A 11: 94,068,090 N313K probably benign Het
Stkld1 T A 2: 26,945,805 H217Q probably benign Het
Stxbp2 T A 8: 3,633,914 F104I possibly damaging Het
Tcf12 A G 9: 71,858,505 V575A possibly damaging Het
Tcf12 A T 9: 71,922,787 S131T probably benign Het
Tg T A 15: 66,681,937 S400R probably benign Het
Tomm40 T C 7: 19,710,778 T200A possibly damaging Het
Trio T C 15: 27,919,237 E71G unknown Het
Zfp292 A T 4: 34,805,982 V2359E probably damaging Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71948486 missense probably benign 0.32
IGL01834:Polr1a APN 6 71948462 missense probably benign
IGL01902:Polr1a APN 6 71963748 missense probably damaging 1.00
IGL02101:Polr1a APN 6 71950802 missense probably benign 0.00
IGL02325:Polr1a APN 6 71920657 missense probably benign 0.38
IGL02398:Polr1a APN 6 71936556 splice site probably benign
IGL02528:Polr1a APN 6 71964717 missense probably benign
IGL02555:Polr1a APN 6 71920457 missense probably damaging 0.98
IGL02613:Polr1a APN 6 71967320 missense probably damaging 1.00
IGL02693:Polr1a APN 6 71963846 splice site probably benign
IGL02892:Polr1a APN 6 71931696 missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71936512 missense probably benign
IGL03174:Polr1a APN 6 71977347 missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71941417 missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71967455 splice site probably benign
R0217:Polr1a UTSW 6 71963703 missense probably benign 0.19
R0267:Polr1a UTSW 6 71974139 missense probably damaging 0.99
R0329:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71920763 splice site probably benign
R0411:Polr1a UTSW 6 71978421 missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71950664 critical splice donor site probably null
R0846:Polr1a UTSW 6 71924643 missense probably damaging 1.00
R1035:Polr1a UTSW 6 71967916 missense probably benign
R1294:Polr1a UTSW 6 71912902 missense probably damaging 0.99
R1460:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R1657:Polr1a UTSW 6 71941535 missense probably damaging 1.00
R1846:Polr1a UTSW 6 71976188 missense probably damaging 0.98
R1862:Polr1a UTSW 6 71909203 missense probably damaging 0.96
R1865:Polr1a UTSW 6 71966524 missense probably damaging 1.00
R1903:Polr1a UTSW 6 71967914 missense probably benign 0.02
R1937:Polr1a UTSW 6 71936552 critical splice donor site probably null
R2063:Polr1a UTSW 6 71936285 splice site probably null
R2071:Polr1a UTSW 6 71976074 missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71950809 missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71972826 critical splice donor site probably null
R2410:Polr1a UTSW 6 71974882 missense probably benign
R3001:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3001:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3924:Polr1a UTSW 6 71929450 missense probably benign 0.00
R4105:Polr1a UTSW 6 71976191 missense probably damaging 0.98
R4125:Polr1a UTSW 6 71965706 missense probably benign 0.00
R4271:Polr1a UTSW 6 71953022 missense probably benign 0.02
R4440:Polr1a UTSW 6 71950848 missense probably damaging 0.98
R4667:Polr1a UTSW 6 71917821 missense probably benign 0.30
R4769:Polr1a UTSW 6 71950868 missense probably benign 0.01
R4801:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4802:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4828:Polr1a UTSW 6 71966401 missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71909229 missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71931709 missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71967925 missense probably damaging 1.00
R5223:Polr1a UTSW 6 71967907 missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71913037 missense probably damaging 1.00
R5546:Polr1a UTSW 6 71929366 missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71967362 missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71929426 missense probably benign 0.05
R5850:Polr1a UTSW 6 71926683 missense probably benign 0.00
R6274:Polr1a UTSW 6 71954890 splice site probably null
R6526:Polr1a UTSW 6 71929443 missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71976041 missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71967374 missense probably damaging 0.98
R6892:Polr1a UTSW 6 71964712 missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71920516 nonsense probably null
R7291:Polr1a UTSW 6 71941456 missense probably benign 0.02
R7311:Polr1a UTSW 6 71950879 missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71926659 missense probably benign 0.14
R7479:Polr1a UTSW 6 71936297 missense probably damaging 1.00
R7607:Polr1a UTSW 6 71913021 missense probably benign
R7739:Polr1a UTSW 6 71954835 missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71941512 missense probably damaging 1.00
R7764:Polr1a UTSW 6 71953070 missense probably damaging 1.00
R7835:Polr1a UTSW 6 71915142 missense probably benign 0.02
R8029:Polr1a UTSW 6 71912956 nonsense probably null
R8057:Polr1a UTSW 6 71931660 missense possibly damaging 0.95
R8144:Polr1a UTSW 6 71950616 missense probably benign
R8170:Polr1a UTSW 6 71920749 missense probably benign
R8320:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R8328:Polr1a UTSW 6 71920734 missense probably benign
R8331:Polr1a UTSW 6 71976179 missense probably damaging 1.00
R8362:Polr1a UTSW 6 71964667 missense probably benign 0.00
R8511:Polr1a UTSW 6 71920520 missense probably benign 0.01
R8745:Polr1a UTSW 6 71954771 missense probably damaging 1.00
R8784:Polr1a UTSW 6 71950628 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGAGGCTAGTAATTCGGGCC -3'
(R):5'- TGGCCCAGCTGTATAGACAC -3'

Sequencing Primer
(F):5'- TAGTAATTCGGGCCAGCGG -3'
(R):5'- GCTGTATAGACACTGACCTGAC -3'
Posted On2021-04-30