Mutagenetix > Incidental Mutation

Incidental Mutation 'R8709:Polr1a'

669431

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

MMRRC Submission

068563-MU

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8709 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 71974848 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1466 (D1466E)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296]

AlphaFold

O35134

Predicted Effect

probably benign
Transcript: ENSMUST00000055296
AA Change: D1466E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: D1466E

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3100002H09Rik	A	G	4: 124,610,523	S79P	unknown	Het
Adamts20	T	A	15: 94,341,066	D757V	probably damaging	Het
Adamts9	C	T	6: 92,807,163	G1570D	probably damaging	Het
Adamtsl3	A	G	7: 82,428,434	Y109C	possibly damaging	Het
Agl	G	A	3: 116,772,472	R335C		Het
Ankfy1	C	A	11: 72,755,706	T805K	possibly damaging	Het
Cast	A	T	13: 74,744,661	V96E	probably damaging	Het
Cdh17	G	T	4: 11,795,685	E422*	probably null	Het
Cox4i1	T	A	8: 120,669,371	L21H	possibly damaging	Het
Cwc22	T	C	2: 77,896,350	E795G	probably benign	Het
Cwf19l2	C	A	9: 3,430,723	Q352K	probably benign	Het
Cyp2d9	T	C	15: 82,455,075	V226A	probably benign	Het
Dnah12	A	G	14: 26,693,602	I53V	probably benign	Het
Dnah7a	T	C	1: 53,635,317	I434V	probably benign	Het
Dock8	C	T	19: 25,078,084	Q137*	probably null	Het
Eif4b	T	G	15: 102,093,681	V515G	unknown	Het
Far2	T	A	6: 148,165,635	N339K	probably benign	Het
Gm13124	C	G	4: 144,555,293	A310P	probably damaging	Het
Gm16486	T	C	8: 70,709,723	C522R	possibly damaging	Het
Gpr22	T	C	12: 31,709,830	T98A	probably damaging	Het
Hamp2	A	G	7: 30,922,549	C72R	probably damaging	Het
Hmgn1	G	A	16: 96,127,340	P16S	possibly damaging	Het
Hspd1	A	G	1: 55,081,763	S256P	probably benign	Het
Iqgap2	T	C	13: 95,660,205	H1147R	probably damaging	Het
Itgb1	T	A	8: 128,713,406		probably benign	Het
Klhl29	A	T	12: 5,090,681	W654R	probably damaging	Het
Krtap22-2	T	A	16: 89,010,626	Y28F	unknown	Het
Lcp2	T	A	11: 34,054,354		probably benign	Het
Muc5ac	T	G	7: 141,816,926	L3225R	possibly damaging	Het
Myom3	A	G	4: 135,796,296	E908G	possibly damaging	Het
Nup54	A	G	5: 92,422,408		probably benign	Het
Olfr1247	C	T	2: 89,610,022	V27I	probably benign	Het
Olfr290	T	A	7: 84,916,463	I228N	probably damaging	Het
Olfr59	T	A	11: 74,289,228	I194N	possibly damaging	Het
Olfr609	T	C	7: 103,492,312	T189A	probably benign	Het
Pak4	A	C	7: 28,562,544	D453E	probably benign	Het
Pkd1l1	T	C	11: 8,855,567	T2120A		Het
Pkhd1l1	T	A	15: 44,518,174	S1099T	probably benign	Het
Pld2	C	T	11: 70,553,449	R524W	probably damaging	Het
Pxdn	C	T	12: 30,006,602	L1271F	probably damaging	Het
Rp1l1	A	C	14: 64,031,846	D1627A	probably damaging	Het
Sephs1	T	C	2: 4,884,591	V60A	probably benign	Het
Sipa1	C	T	19: 5,660,952	R10Q	probably damaging	Het
Sp4	T	C	12: 118,299,454	T286A	possibly damaging	Het
Spag5	T	A	11: 78,301,912	S23R	probably benign	Het
Spag9	T	A	11: 94,068,090	N313K	probably benign	Het
Stag1	T	A	9: 100,890,922		probably benign	Het
Stkld1	T	A	2: 26,945,805	H217Q	probably benign	Het
Stxbp2	T	A	8: 3,633,914	F104I	possibly damaging	Het
Tcf12	A	G	9: 71,858,505	V575A	possibly damaging	Het
Tcf12	A	T	9: 71,922,787	S131T	probably benign	Het
Tg	T	A	15: 66,681,937	S400R	probably benign	Het
Tomm40	T	C	7: 19,710,778	T200A	possibly damaging	Het
Trio	T	C	15: 27,919,237	E71G	unknown	Het
Zfp292	A	T	4: 34,805,982	V2359E	probably damaging	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8511:Polr1a	UTSW	6	71920520	missense	probably benign	0.01
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	probably benign
R9055:Polr1a	UTSW	6	71915069	missense	possibly damaging	0.46
R9088:Polr1a	UTSW	6	71931783	missense	probably benign	0.26
R9211:Polr1a	UTSW	6	71966537	missense	probably damaging	1.00
R9228:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R9240:Polr1a	UTSW	6	71963677	nonsense	probably null
R9267:Polr1a	UTSW	6	71965558	missense	probably benign
R9302:Polr1a	UTSW	6	71924699	critical splice donor site	probably null
R9744:Polr1a	UTSW	6	71929388	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AGAGAGGCTAGTAATTCGGGCC -3'
(R):5'- TGGCCCAGCTGTATAGACAC -3'

Sequencing Primer
(F):5'- TAGTAATTCGGGCCAGCGG -3'
(R):5'- GCTGTATAGACACTGACCTGAC -3'

Posted On

2021-04-30