Incidental Mutation 'R8709:Ankfy1'
ID 669450
Institutional Source Beutler Lab
Gene Symbol Ankfy1
Ensembl Gene ENSMUSG00000020790
Gene Name ankyrin repeat and FYVE domain containing 1
Synonyms Ankhzn
MMRRC Submission
Accession Numbers

Genbank: NM_009671.5

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8709 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 72690006-72772146 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 72755706 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 805 (T805K)
Ref Sequence ENSEMBL: ENSMUSP00000118751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127610] [ENSMUST00000155998]
AlphaFold Q810B6
Predicted Effect probably benign
Transcript: ENSMUST00000127610
SMART Domains Protein: ENSMUSP00000118252
Gene: ENSMUSG00000020790

DomainStartEndE-ValueType
Blast:UBCc 4 33 3e-8 BLAST
BTB 68 162 3.26e-20 SMART
Blast:ANK 217 247 6e-8 BLAST
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 395 4.73e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155998
AA Change: T805K

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118751
Gene: ENSMUSG00000020790
AA Change: T805K

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
BTB 68 162 3.26e-20 SMART
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 396 9.75e1 SMART
ANK 400 452 8.5e2 SMART
low complexity region 465 478 N/A INTRINSIC
ANK 490 519 4.56e-4 SMART
ANK 542 572 3.18e-3 SMART
ANK 588 617 1.72e1 SMART
ANK 621 650 5.16e-3 SMART
ANK 654 683 8.14e-1 SMART
ANK 687 716 5.37e-1 SMART
ANK 724 753 3.08e-1 SMART
ANK 769 798 2.56e-7 SMART
ANK 802 830 1.93e-2 SMART
ANK 836 865 3.47e2 SMART
ANK 870 899 9.49e-2 SMART
ANK 905 934 2.41e-3 SMART
ANK 938 967 1.34e-1 SMART
ANK 971 1001 4.43e-2 SMART
Blast:ANK 1005 1039 2e-16 BLAST
ANK 1043 1074 5.67e0 SMART
FYVE 1099 1165 3.98e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains a coiled-coil structure and a BTB/POZ domain at its N-terminus, ankyrin repeats in the middle portion, and a FYVE-finger motif at its C-terminus. This protein belongs to a subgroup of double zinc finger proteins which may be involved in vesicle or protein transport. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality with no apparent neural developmental defects on a mixed genetic background but show complete embryonic lethality on highly homogenous genetic backgrounds. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik A G 4: 124,610,523 S79P unknown Het
Adamts20 T A 15: 94,341,066 D757V probably damaging Het
Adamts9 C T 6: 92,807,163 G1570D probably damaging Het
Adamtsl3 A G 7: 82,428,434 Y109C possibly damaging Het
Agl G A 3: 116,772,472 R335C Het
Cast A T 13: 74,744,661 V96E probably damaging Het
Cdh17 G T 4: 11,795,685 E422* probably null Het
Cox4i1 T A 8: 120,669,371 L21H possibly damaging Het
Cwc22 T C 2: 77,896,350 E795G probably benign Het
Cwf19l2 C A 9: 3,430,723 Q352K probably benign Het
Cyp2d9 T C 15: 82,455,075 V226A probably benign Het
Dnah12 A G 14: 26,693,602 I53V probably benign Het
Dnah7a T C 1: 53,635,317 I434V probably benign Het
Dock8 C T 19: 25,078,084 Q137* probably null Het
Eif4b T G 15: 102,093,681 V515G unknown Het
Far2 T A 6: 148,165,635 N339K probably benign Het
Gm13124 C G 4: 144,555,293 A310P probably damaging Het
Gm16486 T C 8: 70,709,723 C522R possibly damaging Het
Gpr22 T C 12: 31,709,830 T98A probably damaging Het
Hamp2 A G 7: 30,922,549 C72R probably damaging Het
Hmgn1 G A 16: 96,127,340 P16S possibly damaging Het
Hspd1 A G 1: 55,081,763 S256P probably benign Het
Iqgap2 T C 13: 95,660,205 H1147R probably damaging Het
Itgb1 T A 8: 128,713,406 probably benign Het
Klhl29 A T 12: 5,090,681 W654R probably damaging Het
Krtap22-2 T A 16: 89,010,626 Y28F unknown Het
Lcp2 T A 11: 34,054,354 probably benign Het
Muc5ac T G 7: 141,816,926 L3225R possibly damaging Het
Myom3 A G 4: 135,796,296 E908G possibly damaging Het
Nup54 A G 5: 92,422,408 probably benign Het
Olfr1247 C T 2: 89,610,022 V27I probably benign Het
Olfr290 T A 7: 84,916,463 I228N probably damaging Het
Olfr59 T A 11: 74,289,228 I194N possibly damaging Het
Olfr609 T C 7: 103,492,312 T189A probably benign Het
Pak4 A C 7: 28,562,544 D453E probably benign Het
Pkd1l1 T C 11: 8,855,567 T2120A Het
Pkhd1l1 T A 15: 44,518,174 S1099T probably benign Het
Pld2 C T 11: 70,553,449 R524W probably damaging Het
Polr1a T A 6: 71,974,848 D1466E probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rp1l1 A C 14: 64,031,846 D1627A probably damaging Het
Sephs1 T C 2: 4,884,591 V60A probably benign Het
Sipa1 C T 19: 5,660,952 R10Q probably damaging Het
Sp4 T C 12: 118,299,454 T286A possibly damaging Het
Spag5 T A 11: 78,301,912 S23R probably benign Het
Spag9 T A 11: 94,068,090 N313K probably benign Het
Stag1 T A 9: 100,890,922 probably benign Het
Stkld1 T A 2: 26,945,805 H217Q probably benign Het
Stxbp2 T A 8: 3,633,914 F104I possibly damaging Het
Tcf12 A G 9: 71,858,505 V575A possibly damaging Het
Tcf12 A T 9: 71,922,787 S131T probably benign Het
Tg T A 15: 66,681,937 S400R probably benign Het
Tomm40 T C 7: 19,710,778 T200A possibly damaging Het
Trio T C 15: 27,919,237 E71G unknown Het
Zfp292 A T 4: 34,805,982 V2359E probably damaging Het
Other mutations in Ankfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Ankfy1 APN 11 72728772 missense probably benign 0.03
IGL00837:Ankfy1 APN 11 72755898 splice site probably benign
IGL01061:Ankfy1 APN 11 72728860 nonsense probably null
IGL01305:Ankfy1 APN 11 72764791 missense probably damaging 1.00
IGL01599:Ankfy1 APN 11 72738365 missense probably benign
IGL01918:Ankfy1 APN 11 72740455 missense probably benign 0.09
IGL03007:Ankfy1 APN 11 72750521 missense probably damaging 0.98
IGL03134:Ankfy1 APN 11 72712185 missense probably damaging 1.00
IGL03182:Ankfy1 APN 11 72728754 splice site probably benign
Betruenken UTSW 11 72753608 missense possibly damaging 0.78
Inebriated UTSW 11 72752105 missense probably benign
Smashed UTSW 11 72712204 missense probably damaging 1.00
woozy UTSW 11 72754459 missense probably benign 0.33
ANU22:Ankfy1 UTSW 11 72764791 missense probably damaging 1.00
I2289:Ankfy1 UTSW 11 72730485 missense probably benign 0.01
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0569:Ankfy1 UTSW 11 72753608 missense possibly damaging 0.78
R0787:Ankfy1 UTSW 11 72760296 missense probably damaging 1.00
R1303:Ankfy1 UTSW 11 72750071 splice site probably null
R1522:Ankfy1 UTSW 11 72755867 nonsense probably null
R1552:Ankfy1 UTSW 11 72754495 critical splice donor site probably null
R1565:Ankfy1 UTSW 11 72757318 missense probably damaging 1.00
R1899:Ankfy1 UTSW 11 72754407 nonsense probably null
R1900:Ankfy1 UTSW 11 72754407 nonsense probably null
R1950:Ankfy1 UTSW 11 72760329 missense probably damaging 1.00
R2421:Ankfy1 UTSW 11 72755896 splice site probably benign
R3429:Ankfy1 UTSW 11 72712154 splice site probably benign
R3801:Ankfy1 UTSW 11 72749420 missense probably benign
R4079:Ankfy1 UTSW 11 72690009 utr 5 prime probably benign
R4119:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4120:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4165:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4233:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4234:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4236:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4735:Ankfy1 UTSW 11 72730611 missense probably benign
R4765:Ankfy1 UTSW 11 72712291 missense probably benign 0.05
R4904:Ankfy1 UTSW 11 72752105 missense probably benign
R5057:Ankfy1 UTSW 11 72759919 missense probably damaging 1.00
R5454:Ankfy1 UTSW 11 72746931 missense probably benign 0.00
R5471:Ankfy1 UTSW 11 72728791 missense probably benign 0.01
R5737:Ankfy1 UTSW 11 72732274 missense probably damaging 0.98
R5770:Ankfy1 UTSW 11 72760256 missense probably damaging 1.00
R5896:Ankfy1 UTSW 11 72759985 missense probably damaging 0.98
R5930:Ankfy1 UTSW 11 72712245 missense probably benign 0.00
R5960:Ankfy1 UTSW 11 72757352 missense possibly damaging 0.91
R6169:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6176:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6177:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6178:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6477:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6513:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6521:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6523:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6524:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R7006:Ankfy1 UTSW 11 72740464 missense probably benign 0.01
R7329:Ankfy1 UTSW 11 72712208 missense probably damaging 0.96
R7393:Ankfy1 UTSW 11 72738308 missense possibly damaging 0.70
R7410:Ankfy1 UTSW 11 72761504 missense probably damaging 1.00
R7488:Ankfy1 UTSW 11 72759943 missense probably benign 0.05
R7731:Ankfy1 UTSW 11 72712281 missense probably benign 0.00
R7810:Ankfy1 UTSW 11 72754455 nonsense probably null
R8236:Ankfy1 UTSW 11 72754355 missense possibly damaging 0.90
R8717:Ankfy1 UTSW 11 72730474 missense probably benign 0.01
R8839:Ankfy1 UTSW 11 72730566 missense probably benign 0.39
R8862:Ankfy1 UTSW 11 72753643 missense probably benign 0.18
R8954:Ankfy1 UTSW 11 72750491 missense possibly damaging 0.91
R9548:Ankfy1 UTSW 11 72750179 critical splice donor site probably null
R9762:Ankfy1 UTSW 11 72730575 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATGAAACAGTGTGGTGGG -3'
(R):5'- TGGCAATAGGATAAGTTCTGCTG -3'

Sequencing Primer
(F):5'- GGAGAAGCTGCCAGTCATTTTTATG -3'
(R):5'- GCTGGACACTGACCTGCTC -3'
Posted On 2021-04-30