Incidental Mutation 'R8709:Pxdn'
ID669455
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Nameperoxidasin
SynonymsVPO1, 2310075M15Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R8709 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location29937608-30017658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30006602 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 1271 (L1271F)
Ref Sequence ENSEMBL: ENSMUSP00000113703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122328] [ENSMUST00000220271]
Predicted Effect probably damaging
Transcript: ENSMUST00000122328
AA Change: L1271F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: L1271F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220271
AA Change: L1091F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik A G 4: 124,610,523 S79P unknown Het
Adamts20 T A 15: 94,341,066 D757V probably damaging Het
Adamts9 C T 6: 92,807,163 G1570D probably damaging Het
Adamtsl3 A G 7: 82,428,434 Y109C possibly damaging Het
Agl G A 3: 116,772,472 R335C Het
Ankfy1 C A 11: 72,755,706 T805K possibly damaging Het
Cast A T 13: 74,744,661 V96E probably damaging Het
Cdh17 G T 4: 11,795,685 E422* probably null Het
Cox4i1 T A 8: 120,669,371 L21H possibly damaging Het
Cwc22 T C 2: 77,896,350 E795G probably benign Het
Cwf19l2 C A 9: 3,430,723 Q352K probably benign Het
Cyp2d9 T C 15: 82,455,075 V226A probably benign Het
Dnah12 A G 14: 26,693,602 I53V probably benign Het
Dnah7a T C 1: 53,635,317 I434V probably benign Het
Dock8 C T 19: 25,078,084 Q137* probably null Het
Eif4b T G 15: 102,093,681 V515G unknown Het
Far2 T A 6: 148,165,635 N339K probably benign Het
Gm13124 C G 4: 144,555,293 A310P probably damaging Het
Gm16486 T C 8: 70,709,723 C522R possibly damaging Het
Gpr22 T C 12: 31,709,830 T98A probably damaging Het
Hamp2 A G 7: 30,922,549 C72R probably damaging Het
Hmgn1 G A 16: 96,127,340 P16S possibly damaging Het
Hspd1 A G 1: 55,081,763 S256P probably benign Het
Iqgap2 T C 13: 95,660,205 H1147R probably damaging Het
Itgb1 T A 8: 128,713,406 probably benign Het
Klhl29 A T 12: 5,090,681 W654R probably damaging Het
Krtap22-2 T A 16: 89,010,626 Y28F unknown Het
Lcp2 T A 11: 34,054,354 probably benign Het
Muc5ac T G 7: 141,816,926 L3225R possibly damaging Het
Myom3 A G 4: 135,796,296 E908G possibly damaging Het
Nup54 A G 5: 92,422,408 probably benign Het
Olfr1247 C T 2: 89,610,022 V27I probably benign Het
Olfr290 T A 7: 84,916,463 I228N probably damaging Het
Olfr59 T A 11: 74,289,228 I194N possibly damaging Het
Olfr609 T C 7: 103,492,312 T189A probably benign Het
Pak4 A C 7: 28,562,544 D453E probably benign Het
Pkd1l1 T C 11: 8,855,567 T2120A Het
Pkhd1l1 T A 15: 44,518,174 S1099T probably benign Het
Pld2 C T 11: 70,553,449 R524W probably damaging Het
Polr1a T A 6: 71,974,848 D1466E probably benign Het
Rp1l1 A C 14: 64,031,846 D1627A probably damaging Het
Sephs1 T C 2: 4,884,591 V60A probably benign Het
Sipa1 C T 19: 5,660,952 R10Q probably damaging Het
Sp4 T C 12: 118,299,454 T286A possibly damaging Het
Spag5 T A 11: 78,301,912 S23R probably benign Het
Spag9 T A 11: 94,068,090 N313K probably benign Het
Stag1 T A 9: 100,890,922 probably benign Het
Stkld1 T A 2: 26,945,805 H217Q probably benign Het
Stxbp2 T A 8: 3,633,914 F104I possibly damaging Het
Tcf12 A G 9: 71,858,505 V575A possibly damaging Het
Tcf12 A T 9: 71,922,787 S131T probably benign Het
Tg T A 15: 66,681,937 S400R probably benign Het
Tomm40 T C 7: 19,710,778 T200A possibly damaging Het
Trio T C 15: 27,919,237 E71G unknown Het
Zfp292 A T 4: 34,805,982 V2359E probably damaging Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4280001:Pxdn UTSW 12 29995328 missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0140:Pxdn UTSW 12 29982754 missense probably benign 0.04
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R0885:Pxdn UTSW 12 30003402 missense probably benign 0.30
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4576:Pxdn UTSW 12 30011923 missense probably benign
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5504:Pxdn UTSW 12 30002801 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5739:Pxdn UTSW 12 29982334 missense probably benign 0.03
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6609:Pxdn UTSW 12 30002941 missense probably benign 0.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6921:Pxdn UTSW 12 30015505 missense probably damaging 0.96
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
R7347:Pxdn UTSW 12 30012261 missense probably benign 0.01
R7402:Pxdn UTSW 12 30002439 missense probably damaging 1.00
R7408:Pxdn UTSW 12 29990945 missense probably benign 0.29
R7413:Pxdn UTSW 12 30002928 missense probably benign 0.00
R7447:Pxdn UTSW 12 29984927 missense probably damaging 1.00
R7572:Pxdn UTSW 12 30006705 missense probably damaging 1.00
R7708:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R7815:Pxdn UTSW 12 30005825 missense probably damaging 0.96
R7972:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8097:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8098:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8205:Pxdn UTSW 12 30006567 missense probably damaging 1.00
R8262:Pxdn UTSW 12 29999196 nonsense probably null
R8335:Pxdn UTSW 12 30002097 missense probably damaging 0.99
R8356:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8437:Pxdn UTSW 12 30002044 missense probably damaging 1.00
R8456:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8772:Pxdn UTSW 12 30015464 missense probably damaging 1.00
Z1177:Pxdn UTSW 12 29990852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTAACTGAATCCATGATTTCC -3'
(R):5'- AAAGGCCACTTTCCCCGTTC -3'

Sequencing Primer
(F):5'- CTGAATCCATGATTTCCATATTGGC -3'
(R):5'- CGTTCTCAGGCAAAGCAGCAG -3'
Posted On2021-04-30