Incidental Mutation 'R8709:Iqgap2'
ID669459
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8709 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95660205 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1147 (H1147R)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect probably damaging
Transcript: ENSMUST00000068603
AA Change: H1147R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: H1147R

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik A G 4: 124,610,523 S79P unknown Het
Adamts20 T A 15: 94,341,066 D757V probably damaging Het
Adamts9 C T 6: 92,807,163 G1570D probably damaging Het
Adamtsl3 A G 7: 82,428,434 Y109C possibly damaging Het
Agl G A 3: 116,772,472 R335C Het
Ankfy1 C A 11: 72,755,706 T805K possibly damaging Het
Cast A T 13: 74,744,661 V96E probably damaging Het
Cdh17 G T 4: 11,795,685 E422* probably null Het
Cox4i1 T A 8: 120,669,371 L21H possibly damaging Het
Cwc22 T C 2: 77,896,350 E795G probably benign Het
Cwf19l2 C A 9: 3,430,723 Q352K probably benign Het
Cyp2d9 T C 15: 82,455,075 V226A probably benign Het
Dnah12 A G 14: 26,693,602 I53V probably benign Het
Dnah7a T C 1: 53,635,317 I434V probably benign Het
Dock8 C T 19: 25,078,084 Q137* probably null Het
Eif4b T G 15: 102,093,681 V515G unknown Het
Far2 T A 6: 148,165,635 N339K probably benign Het
Gm13124 C G 4: 144,555,293 A310P probably damaging Het
Gm16486 T C 8: 70,709,723 C522R possibly damaging Het
Gpr22 T C 12: 31,709,830 T98A probably damaging Het
Hamp2 A G 7: 30,922,549 C72R probably damaging Het
Hmgn1 G A 16: 96,127,340 P16S possibly damaging Het
Hspd1 A G 1: 55,081,763 S256P probably benign Het
Klhl29 A T 12: 5,090,681 W654R probably damaging Het
Krtap22-2 T A 16: 89,010,626 Y28F unknown Het
Lcp2 T A 11: 34,054,354 probably benign Het
Muc5ac T G 7: 141,816,926 L3225R possibly damaging Het
Myom3 A G 4: 135,796,296 E908G possibly damaging Het
Olfr1247 C T 2: 89,610,022 V27I probably benign Het
Olfr290 T A 7: 84,916,463 I228N probably damaging Het
Olfr59 T A 11: 74,289,228 I194N possibly damaging Het
Olfr609 T C 7: 103,492,312 T189A probably benign Het
Pak4 A C 7: 28,562,544 D453E probably benign Het
Pkd1l1 T C 11: 8,855,567 T2120A Het
Pkhd1l1 T A 15: 44,518,174 S1099T probably benign Het
Pld2 C T 11: 70,553,449 R524W probably damaging Het
Polr1a T A 6: 71,974,848 D1466E probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rp1l1 A C 14: 64,031,846 D1627A probably damaging Het
Sephs1 T C 2: 4,884,591 V60A probably benign Het
Sipa1 C T 19: 5,660,952 R10Q probably damaging Het
Sp4 T C 12: 118,299,454 T286A possibly damaging Het
Spag5 T A 11: 78,301,912 S23R probably benign Het
Spag9 T A 11: 94,068,090 N313K probably benign Het
Stkld1 T A 2: 26,945,805 H217Q probably benign Het
Stxbp2 T A 8: 3,633,914 F104I possibly damaging Het
Tcf12 A G 9: 71,858,505 V575A possibly damaging Het
Tcf12 A T 9: 71,922,787 S131T probably benign Het
Tg T A 15: 66,681,937 S400R probably benign Het
Tomm40 T C 7: 19,710,778 T200A possibly damaging Het
Trio T C 15: 27,919,237 E71G unknown Het
Zfp292 A T 4: 34,805,982 V2359E probably damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95660151 missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95660248 missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95665750 missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTATCCAGGGCAGTTGCTG -3'
(R):5'- AAAGCAACTAGAGCTCATTTGTCTC -3'

Sequencing Primer
(F):5'- TGGGGATACAGCCTCGTG -3'
(R):5'- CCGATGGCTTTGACATCAT -3'
Posted On2021-04-30