Incidental Mutation 'R8709:Pkhd1l1'
ID 669463
Institutional Source Beutler Lab
Gene Symbol Pkhd1l1
Ensembl Gene ENSMUSG00000038725
Gene Name polycystic kidney and hepatic disease 1-like 1
Synonyms fibrocystin L, D86 mRNA, PKHDL1
MMRRC Submission 068563-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8709 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 44320890-44464765 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 44381570 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1099 (S1099T)
Ref Sequence ENSEMBL: ENSMUSP00000036988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038336] [ENSMUST00000166957] [ENSMUST00000209244]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000038336
AA Change: S1099T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000036988
Gene: ENSMUSG00000038725
AA Change: S1099T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 1.6e-16 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1322 1.1e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 5.1e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 2.1e-10 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166957
AA Change: S1099T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000129522
Gene: ENSMUSG00000038725
AA Change: S1099T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 9.4e-18 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1323 3e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 3.7e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 9.7e-12 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209244
AA Change: S1099T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik A G 4: 124,504,316 (GRCm39) S79P unknown Het
Aadacl4fm2 C G 4: 144,281,863 (GRCm39) A310P probably damaging Het
Adamts20 T A 15: 94,238,947 (GRCm39) D757V probably damaging Het
Adamts9 C T 6: 92,784,144 (GRCm39) G1570D probably damaging Het
Adamtsl3 A G 7: 82,077,642 (GRCm39) Y109C possibly damaging Het
Agl G A 3: 116,566,121 (GRCm39) R335C Het
Ankfy1 C A 11: 72,646,532 (GRCm39) T805K possibly damaging Het
Cast A T 13: 74,892,780 (GRCm39) V96E probably damaging Het
Cdh17 G T 4: 11,795,685 (GRCm39) E422* probably null Het
Cox4i1 T A 8: 121,396,110 (GRCm39) L21H possibly damaging Het
Cwc22 T C 2: 77,726,694 (GRCm39) E795G probably benign Het
Cwf19l2 C A 9: 3,430,723 (GRCm39) Q352K probably benign Het
Cyp2d9 T C 15: 82,339,276 (GRCm39) V226A probably benign Het
Dnah12 A G 14: 26,414,757 (GRCm39) I53V probably benign Het
Dnah7a T C 1: 53,674,476 (GRCm39) I434V probably benign Het
Dock8 C T 19: 25,055,448 (GRCm39) Q137* probably null Het
Eif4b T G 15: 102,002,116 (GRCm39) V515G unknown Het
Far2 T A 6: 148,067,133 (GRCm39) N339K probably benign Het
Gpr22 T C 12: 31,759,829 (GRCm39) T98A probably damaging Het
Hamp2 A G 7: 30,621,974 (GRCm39) C72R probably damaging Het
Hmgn1 G A 16: 95,928,540 (GRCm39) P16S possibly damaging Het
Hspd1 A G 1: 55,120,922 (GRCm39) S256P probably benign Het
Iqcn T C 8: 71,162,372 (GRCm39) C522R possibly damaging Het
Iqgap2 T C 13: 95,796,713 (GRCm39) H1147R probably damaging Het
Itgb1 T A 8: 129,439,887 (GRCm39) probably benign Het
Klhl29 A T 12: 5,140,681 (GRCm39) W654R probably damaging Het
Krtap22-2 T A 16: 88,807,514 (GRCm39) Y28F unknown Het
Lcp2 T A 11: 34,004,354 (GRCm39) probably benign Het
Muc5ac T G 7: 141,370,663 (GRCm39) L3225R possibly damaging Het
Myom3 A G 4: 135,523,607 (GRCm39) E908G possibly damaging Het
Nup54 A G 5: 92,570,267 (GRCm39) probably benign Het
Or1p1 T A 11: 74,180,054 (GRCm39) I194N possibly damaging Het
Or4a74 C T 2: 89,440,366 (GRCm39) V27I probably benign Het
Or51af1 T C 7: 103,141,519 (GRCm39) T189A probably benign Het
Or5ae1 T A 7: 84,565,671 (GRCm39) I228N probably damaging Het
Pak4 A C 7: 28,261,969 (GRCm39) D453E probably benign Het
Pkd1l1 T C 11: 8,805,567 (GRCm39) T2120A Het
Pld2 C T 11: 70,444,275 (GRCm39) R524W probably damaging Het
Polr1a T A 6: 71,951,832 (GRCm39) D1466E probably benign Het
Pxdn C T 12: 30,056,601 (GRCm39) L1271F probably damaging Het
Rp1l1 A C 14: 64,269,295 (GRCm39) D1627A probably damaging Het
Sephs1 T C 2: 4,889,402 (GRCm39) V60A probably benign Het
Sipa1 C T 19: 5,710,980 (GRCm39) R10Q probably damaging Het
Sp4 T C 12: 118,263,189 (GRCm39) T286A possibly damaging Het
Spag5 T A 11: 78,192,738 (GRCm39) S23R probably benign Het
Spag9 T A 11: 93,958,916 (GRCm39) N313K probably benign Het
Stag1 T A 9: 100,772,975 (GRCm39) probably benign Het
Stkld1 T A 2: 26,835,817 (GRCm39) H217Q probably benign Het
Stxbp2 T A 8: 3,683,914 (GRCm39) F104I possibly damaging Het
Tcf12 A G 9: 71,765,787 (GRCm39) V575A possibly damaging Het
Tcf12 A T 9: 71,830,069 (GRCm39) S131T probably benign Het
Tg T A 15: 66,553,786 (GRCm39) S400R probably benign Het
Tomm40 T C 7: 19,444,703 (GRCm39) T200A possibly damaging Het
Trio T C 15: 27,919,323 (GRCm39) E71G unknown Het
Zfp292 A T 4: 34,805,982 (GRCm39) V2359E probably damaging Het
Other mutations in Pkhd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Pkhd1l1 APN 15 44,340,982 (GRCm39) missense probably damaging 1.00
IGL00235:Pkhd1l1 APN 15 44,419,415 (GRCm39) missense probably damaging 1.00
IGL00264:Pkhd1l1 APN 15 44,354,425 (GRCm39) missense possibly damaging 0.67
IGL00537:Pkhd1l1 APN 15 44,455,388 (GRCm39) missense possibly damaging 0.88
IGL00537:Pkhd1l1 APN 15 44,363,443 (GRCm39) missense probably benign 0.42
IGL00580:Pkhd1l1 APN 15 44,449,870 (GRCm39) missense probably damaging 0.98
IGL01085:Pkhd1l1 APN 15 44,426,148 (GRCm39) splice site probably null
IGL01089:Pkhd1l1 APN 15 44,347,265 (GRCm39) splice site probably benign
IGL01094:Pkhd1l1 APN 15 44,410,325 (GRCm39) missense probably benign 0.09
IGL01120:Pkhd1l1 APN 15 44,368,708 (GRCm39) critical splice donor site probably null
IGL01307:Pkhd1l1 APN 15 44,393,425 (GRCm39) missense possibly damaging 0.82
IGL01362:Pkhd1l1 APN 15 44,396,378 (GRCm39) missense probably benign 0.00
IGL01403:Pkhd1l1 APN 15 44,347,229 (GRCm39) nonsense probably null
IGL01546:Pkhd1l1 APN 15 44,429,712 (GRCm39) missense probably damaging 1.00
IGL01596:Pkhd1l1 APN 15 44,392,806 (GRCm39) missense possibly damaging 0.50
IGL01696:Pkhd1l1 APN 15 44,392,747 (GRCm39) missense possibly damaging 0.79
IGL01844:Pkhd1l1 APN 15 44,362,796 (GRCm39) splice site probably benign
IGL02007:Pkhd1l1 APN 15 44,397,129 (GRCm39) splice site probably benign
IGL02041:Pkhd1l1 APN 15 44,356,452 (GRCm39) splice site probably null
IGL02171:Pkhd1l1 APN 15 44,379,542 (GRCm39) missense possibly damaging 0.80
IGL02206:Pkhd1l1 APN 15 44,376,245 (GRCm39) missense probably benign 0.08
IGL02266:Pkhd1l1 APN 15 44,437,010 (GRCm39) missense probably damaging 1.00
IGL02487:Pkhd1l1 APN 15 44,322,822 (GRCm39) missense possibly damaging 0.65
IGL02488:Pkhd1l1 APN 15 44,421,993 (GRCm39) missense probably benign
IGL02522:Pkhd1l1 APN 15 44,419,298 (GRCm39) missense possibly damaging 0.71
IGL02554:Pkhd1l1 APN 15 44,441,896 (GRCm39) missense probably damaging 1.00
IGL02566:Pkhd1l1 APN 15 44,389,450 (GRCm39) splice site probably null
IGL02602:Pkhd1l1 APN 15 44,421,327 (GRCm39) missense probably damaging 1.00
IGL02606:Pkhd1l1 APN 15 44,452,852 (GRCm39) missense probably benign 0.00
IGL02623:Pkhd1l1 APN 15 44,448,269 (GRCm39) missense probably damaging 1.00
IGL02634:Pkhd1l1 APN 15 44,403,063 (GRCm39) missense probably damaging 1.00
IGL02637:Pkhd1l1 APN 15 44,427,720 (GRCm39) missense probably damaging 1.00
IGL02651:Pkhd1l1 APN 15 44,347,210 (GRCm39) missense probably damaging 1.00
IGL02679:Pkhd1l1 APN 15 44,393,441 (GRCm39) critical splice donor site probably null
IGL02684:Pkhd1l1 APN 15 44,379,605 (GRCm39) critical splice donor site probably null
IGL02739:Pkhd1l1 APN 15 44,404,346 (GRCm39) missense probably benign 0.11
IGL02831:Pkhd1l1 APN 15 44,364,889 (GRCm39) missense probably benign 0.18
IGL02839:Pkhd1l1 APN 15 44,392,939 (GRCm39) missense probably damaging 0.98
IGL02944:Pkhd1l1 APN 15 44,364,927 (GRCm39) missense probably damaging 1.00
IGL02957:Pkhd1l1 APN 15 44,376,304 (GRCm39) missense probably damaging 1.00
IGL03001:Pkhd1l1 APN 15 44,421,400 (GRCm39) missense probably damaging 1.00
IGL03030:Pkhd1l1 APN 15 44,460,298 (GRCm39) missense probably benign 0.41
IGL03030:Pkhd1l1 APN 15 44,455,372 (GRCm39) missense probably benign 0.00
IGL03132:Pkhd1l1 APN 15 44,438,013 (GRCm39) missense probably damaging 1.00
IGL03194:Pkhd1l1 APN 15 44,381,531 (GRCm39) missense probably damaging 1.00
IGL03219:Pkhd1l1 APN 15 44,460,291 (GRCm39) missense possibly damaging 0.62
IGL03236:Pkhd1l1 APN 15 44,445,222 (GRCm39) missense probably damaging 1.00
IGL03266:Pkhd1l1 APN 15 44,402,348 (GRCm39) missense probably damaging 1.00
IGL03276:Pkhd1l1 APN 15 44,457,980 (GRCm39) missense possibly damaging 0.77
IGL03284:Pkhd1l1 APN 15 44,410,914 (GRCm39) splice site probably benign
IGL03377:Pkhd1l1 APN 15 44,347,747 (GRCm39) splice site probably null
R0310_Pkhd1l1_251 UTSW 15 44,386,134 (GRCm39) splice site probably benign
R0344_Pkhd1l1_462 UTSW 15 44,460,407 (GRCm39) missense probably benign 0.15
R1737_Pkhd1l1_815 UTSW 15 44,410,905 (GRCm39) critical splice donor site probably null
R5049_Pkhd1l1_556 UTSW 15 44,321,012 (GRCm39) missense probably benign 0.00
K7371:Pkhd1l1 UTSW 15 44,363,463 (GRCm39) missense possibly damaging 0.94
K7371:Pkhd1l1 UTSW 15 44,400,838 (GRCm39) missense possibly damaging 0.67
N/A - 287:Pkhd1l1 UTSW 15 44,445,654 (GRCm39) missense probably damaging 0.98
P4717OSA:Pkhd1l1 UTSW 15 44,391,643 (GRCm39) missense probably damaging 1.00
P4717OSA:Pkhd1l1 UTSW 15 44,386,895 (GRCm39) missense probably benign 0.17
R0007:Pkhd1l1 UTSW 15 44,437,794 (GRCm39) splice site probably benign
R0020:Pkhd1l1 UTSW 15 44,420,268 (GRCm39) missense probably damaging 1.00
R0034:Pkhd1l1 UTSW 15 44,367,405 (GRCm39) missense probably benign 0.00
R0040:Pkhd1l1 UTSW 15 44,437,021 (GRCm39) missense probably damaging 1.00
R0050:Pkhd1l1 UTSW 15 44,437,203 (GRCm39) missense possibly damaging 0.79
R0050:Pkhd1l1 UTSW 15 44,437,203 (GRCm39) missense possibly damaging 0.79
R0063:Pkhd1l1 UTSW 15 44,392,633 (GRCm39) missense probably damaging 1.00
R0063:Pkhd1l1 UTSW 15 44,392,633 (GRCm39) missense probably damaging 1.00
R0086:Pkhd1l1 UTSW 15 44,419,404 (GRCm39) missense possibly damaging 0.94
R0103:Pkhd1l1 UTSW 15 44,460,537 (GRCm39) missense probably benign
R0103:Pkhd1l1 UTSW 15 44,460,537 (GRCm39) missense probably benign
R0127:Pkhd1l1 UTSW 15 44,418,001 (GRCm39) missense probably damaging 0.99
R0226:Pkhd1l1 UTSW 15 44,390,180 (GRCm39) missense possibly damaging 0.65
R0268:Pkhd1l1 UTSW 15 44,460,407 (GRCm39) missense probably benign 0.15
R0294:Pkhd1l1 UTSW 15 44,423,831 (GRCm39) missense probably benign 0.05
R0310:Pkhd1l1 UTSW 15 44,386,134 (GRCm39) splice site probably benign
R0344:Pkhd1l1 UTSW 15 44,460,407 (GRCm39) missense probably benign 0.15
R0449:Pkhd1l1 UTSW 15 44,364,915 (GRCm39) missense probably damaging 1.00
R0492:Pkhd1l1 UTSW 15 44,383,086 (GRCm39) missense probably benign 0.03
R0505:Pkhd1l1 UTSW 15 44,452,814 (GRCm39) missense probably damaging 1.00
R0529:Pkhd1l1 UTSW 15 44,390,150 (GRCm39) missense possibly damaging 0.62
R0543:Pkhd1l1 UTSW 15 44,386,887 (GRCm39) critical splice acceptor site probably null
R0552:Pkhd1l1 UTSW 15 44,352,942 (GRCm39) missense probably damaging 0.98
R0558:Pkhd1l1 UTSW 15 44,347,820 (GRCm39) missense probably damaging 0.97
R0609:Pkhd1l1 UTSW 15 44,330,820 (GRCm39) missense possibly damaging 0.48
R0619:Pkhd1l1 UTSW 15 44,347,234 (GRCm39) missense probably damaging 1.00
R0727:Pkhd1l1 UTSW 15 44,399,184 (GRCm39) missense possibly damaging 0.80
R0787:Pkhd1l1 UTSW 15 44,392,660 (GRCm39) missense probably damaging 1.00
R0846:Pkhd1l1 UTSW 15 44,358,993 (GRCm39) missense probably damaging 1.00
R0909:Pkhd1l1 UTSW 15 44,402,279 (GRCm39) splice site probably null
R0942:Pkhd1l1 UTSW 15 44,396,355 (GRCm39) missense probably benign 0.01
R1056:Pkhd1l1 UTSW 15 44,455,360 (GRCm39) missense probably damaging 1.00
R1147:Pkhd1l1 UTSW 15 44,400,837 (GRCm39) missense probably null 0.15
R1147:Pkhd1l1 UTSW 15 44,400,837 (GRCm39) missense probably null 0.15
R1187:Pkhd1l1 UTSW 15 44,361,447 (GRCm39) missense possibly damaging 0.65
R1328:Pkhd1l1 UTSW 15 44,361,392 (GRCm39) missense probably benign 0.01
R1331:Pkhd1l1 UTSW 15 44,452,993 (GRCm39) missense probably damaging 1.00
R1331:Pkhd1l1 UTSW 15 44,368,943 (GRCm39) missense probably damaging 1.00
R1332:Pkhd1l1 UTSW 15 44,368,943 (GRCm39) missense probably damaging 1.00
R1335:Pkhd1l1 UTSW 15 44,368,943 (GRCm39) missense probably damaging 1.00
R1338:Pkhd1l1 UTSW 15 44,390,120 (GRCm39) missense probably damaging 1.00
R1440:Pkhd1l1 UTSW 15 44,404,384 (GRCm39) splice site probably benign
R1445:Pkhd1l1 UTSW 15 44,369,040 (GRCm39) missense probably benign 0.32
R1458:Pkhd1l1 UTSW 15 44,379,511 (GRCm39) missense probably benign 0.01
R1469:Pkhd1l1 UTSW 15 44,400,282 (GRCm39) missense probably benign 0.45
R1469:Pkhd1l1 UTSW 15 44,400,282 (GRCm39) missense probably benign 0.45
R1500:Pkhd1l1 UTSW 15 44,408,890 (GRCm39) missense probably damaging 1.00
R1528:Pkhd1l1 UTSW 15 44,390,120 (GRCm39) missense probably damaging 1.00
R1542:Pkhd1l1 UTSW 15 44,391,587 (GRCm39) missense probably benign 0.44
R1568:Pkhd1l1 UTSW 15 44,408,897 (GRCm39) splice site probably null
R1571:Pkhd1l1 UTSW 15 44,390,237 (GRCm39) missense probably benign
R1572:Pkhd1l1 UTSW 15 44,406,869 (GRCm39) missense probably benign 0.01
R1604:Pkhd1l1 UTSW 15 44,330,763 (GRCm39) nonsense probably null
R1638:Pkhd1l1 UTSW 15 44,460,513 (GRCm39) missense probably benign 0.06
R1639:Pkhd1l1 UTSW 15 44,404,351 (GRCm39) missense probably damaging 0.99
R1737:Pkhd1l1 UTSW 15 44,410,905 (GRCm39) critical splice donor site probably null
R1816:Pkhd1l1 UTSW 15 44,391,635 (GRCm39) missense possibly damaging 0.91
R1826:Pkhd1l1 UTSW 15 44,366,741 (GRCm39) missense possibly damaging 0.75
R1880:Pkhd1l1 UTSW 15 44,388,638 (GRCm39) missense probably benign 0.13
R1930:Pkhd1l1 UTSW 15 44,366,733 (GRCm39) missense possibly damaging 0.69
R1933:Pkhd1l1 UTSW 15 44,404,280 (GRCm39) missense possibly damaging 0.48
R1938:Pkhd1l1 UTSW 15 44,363,434 (GRCm39) missense probably benign
R1975:Pkhd1l1 UTSW 15 44,393,109 (GRCm39) missense probably damaging 1.00
R1999:Pkhd1l1 UTSW 15 44,363,378 (GRCm39) splice site probably null
R2037:Pkhd1l1 UTSW 15 44,431,617 (GRCm39) splice site probably null
R2045:Pkhd1l1 UTSW 15 44,343,050 (GRCm39) missense probably damaging 1.00
R2049:Pkhd1l1 UTSW 15 44,445,137 (GRCm39) missense probably damaging 1.00
R2049:Pkhd1l1 UTSW 15 44,410,909 (GRCm39) splice site probably benign
R2063:Pkhd1l1 UTSW 15 44,414,148 (GRCm39) missense possibly damaging 0.69
R2072:Pkhd1l1 UTSW 15 44,422,035 (GRCm39) missense probably damaging 1.00
R2073:Pkhd1l1 UTSW 15 44,422,035 (GRCm39) missense probably damaging 1.00
R2075:Pkhd1l1 UTSW 15 44,422,035 (GRCm39) missense probably damaging 1.00
R2078:Pkhd1l1 UTSW 15 44,391,163 (GRCm39) missense probably benign 0.08
R2116:Pkhd1l1 UTSW 15 44,432,878 (GRCm39) missense probably damaging 0.97
R2133:Pkhd1l1 UTSW 15 44,379,581 (GRCm39) missense possibly damaging 0.91
R2138:Pkhd1l1 UTSW 15 44,364,853 (GRCm39) missense probably damaging 1.00
R2139:Pkhd1l1 UTSW 15 44,393,214 (GRCm39) missense possibly damaging 0.46
R2145:Pkhd1l1 UTSW 15 44,376,273 (GRCm39) splice site probably null
R2150:Pkhd1l1 UTSW 15 44,363,378 (GRCm39) splice site probably null
R2177:Pkhd1l1 UTSW 15 44,322,791 (GRCm39) missense probably benign
R2184:Pkhd1l1 UTSW 15 44,362,692 (GRCm39) missense possibly damaging 0.89
R2216:Pkhd1l1 UTSW 15 44,437,291 (GRCm39) missense probably damaging 1.00
R2226:Pkhd1l1 UTSW 15 44,376,188 (GRCm39) missense possibly damaging 0.79
R2227:Pkhd1l1 UTSW 15 44,376,188 (GRCm39) missense possibly damaging 0.79
R2243:Pkhd1l1 UTSW 15 44,410,323 (GRCm39) missense probably damaging 1.00
R2290:Pkhd1l1 UTSW 15 44,391,646 (GRCm39) missense probably benign 0.03
R2294:Pkhd1l1 UTSW 15 44,343,003 (GRCm39) missense probably damaging 0.99
R2346:Pkhd1l1 UTSW 15 44,423,902 (GRCm39) missense possibly damaging 0.82
R2356:Pkhd1l1 UTSW 15 44,396,415 (GRCm39) missense probably benign 0.00
R2386:Pkhd1l1 UTSW 15 44,391,574 (GRCm39) missense probably benign 0.00
R2404:Pkhd1l1 UTSW 15 44,414,216 (GRCm39) missense probably damaging 1.00
R2504:Pkhd1l1 UTSW 15 44,348,824 (GRCm39) missense probably damaging 0.97
R2679:Pkhd1l1 UTSW 15 44,408,782 (GRCm39) missense probably damaging 0.99
R2860:Pkhd1l1 UTSW 15 44,404,267 (GRCm39) missense probably damaging 1.00
R2861:Pkhd1l1 UTSW 15 44,404,267 (GRCm39) missense probably damaging 1.00
R2862:Pkhd1l1 UTSW 15 44,404,267 (GRCm39) missense probably damaging 1.00
R2972:Pkhd1l1 UTSW 15 44,410,644 (GRCm39) missense possibly damaging 0.65
R3016:Pkhd1l1 UTSW 15 44,408,766 (GRCm39) missense probably benign 0.02
R3162:Pkhd1l1 UTSW 15 44,368,924 (GRCm39) missense probably damaging 1.00
R3162:Pkhd1l1 UTSW 15 44,368,924 (GRCm39) missense probably damaging 1.00
R3416:Pkhd1l1 UTSW 15 44,410,760 (GRCm39) missense probably damaging 1.00
R3623:Pkhd1l1 UTSW 15 44,390,265 (GRCm39) missense probably damaging 1.00
R3687:Pkhd1l1 UTSW 15 44,409,983 (GRCm39) missense probably benign 0.17
R3755:Pkhd1l1 UTSW 15 44,452,802 (GRCm39) missense probably damaging 1.00
R3776:Pkhd1l1 UTSW 15 44,378,371 (GRCm39) critical splice donor site probably null
R3803:Pkhd1l1 UTSW 15 44,356,531 (GRCm39) missense probably benign 0.25
R3942:Pkhd1l1 UTSW 15 44,455,422 (GRCm39) critical splice donor site probably null
R4010:Pkhd1l1 UTSW 15 44,392,496 (GRCm39) missense possibly damaging 0.80
R4049:Pkhd1l1 UTSW 15 44,361,953 (GRCm39) missense probably damaging 1.00
R4059:Pkhd1l1 UTSW 15 44,414,156 (GRCm39) missense probably benign 0.01
R4179:Pkhd1l1 UTSW 15 44,387,045 (GRCm39) missense probably benign 0.45
R4184:Pkhd1l1 UTSW 15 44,455,302 (GRCm39) missense probably benign 0.00
R4369:Pkhd1l1 UTSW 15 44,368,949 (GRCm39) missense probably benign 0.00
R4462:Pkhd1l1 UTSW 15 44,445,200 (GRCm39) missense probably damaging 1.00
R4551:Pkhd1l1 UTSW 15 44,414,281 (GRCm39) missense probably damaging 1.00
R4618:Pkhd1l1 UTSW 15 44,403,078 (GRCm39) missense probably damaging 1.00
R4632:Pkhd1l1 UTSW 15 44,347,796 (GRCm39) missense probably benign 0.07
R4657:Pkhd1l1 UTSW 15 44,410,743 (GRCm39) missense probably damaging 1.00
R4716:Pkhd1l1 UTSW 15 44,419,428 (GRCm39) missense probably damaging 1.00
R4788:Pkhd1l1 UTSW 15 44,361,417 (GRCm39) missense probably damaging 0.99
R4828:Pkhd1l1 UTSW 15 44,392,801 (GRCm39) missense possibly damaging 0.55
R4858:Pkhd1l1 UTSW 15 44,354,497 (GRCm39) missense probably damaging 0.99
R4860:Pkhd1l1 UTSW 15 44,400,774 (GRCm39) missense possibly damaging 0.77
R4860:Pkhd1l1 UTSW 15 44,400,774 (GRCm39) missense possibly damaging 0.77
R4951:Pkhd1l1 UTSW 15 44,397,287 (GRCm39) missense possibly damaging 0.82
R4963:Pkhd1l1 UTSW 15 44,367,421 (GRCm39) missense probably benign 0.00
R5023:Pkhd1l1 UTSW 15 44,391,587 (GRCm39) missense probably benign 0.44
R5023:Pkhd1l1 UTSW 15 44,445,623 (GRCm39) missense probably benign 0.00
R5035:Pkhd1l1 UTSW 15 44,431,720 (GRCm39) missense probably damaging 1.00
R5049:Pkhd1l1 UTSW 15 44,321,012 (GRCm39) missense probably benign 0.00
R5065:Pkhd1l1 UTSW 15 44,445,689 (GRCm39) missense possibly damaging 0.68
R5089:Pkhd1l1 UTSW 15 44,455,283 (GRCm39) missense probably benign 0.01
R5151:Pkhd1l1 UTSW 15 44,368,705 (GRCm39) missense probably benign 0.00
R5153:Pkhd1l1 UTSW 15 44,368,705 (GRCm39) missense probably benign 0.00
R5189:Pkhd1l1 UTSW 15 44,410,544 (GRCm39) missense probably damaging 1.00
R5204:Pkhd1l1 UTSW 15 44,410,437 (GRCm39) missense possibly damaging 0.51
R5216:Pkhd1l1 UTSW 15 44,359,043 (GRCm39) nonsense probably null
R5286:Pkhd1l1 UTSW 15 44,378,368 (GRCm39) nonsense probably null
R5292:Pkhd1l1 UTSW 15 44,392,962 (GRCm39) missense probably damaging 1.00
R5293:Pkhd1l1 UTSW 15 44,399,146 (GRCm39) missense probably benign 0.01
R5298:Pkhd1l1 UTSW 15 44,367,442 (GRCm39) missense probably benign 0.00
R5327:Pkhd1l1 UTSW 15 44,410,258 (GRCm39) missense probably damaging 1.00
R5346:Pkhd1l1 UTSW 15 44,404,363 (GRCm39) missense probably damaging 1.00
R5481:Pkhd1l1 UTSW 15 44,422,042 (GRCm39) missense probably damaging 1.00
R5645:Pkhd1l1 UTSW 15 44,396,388 (GRCm39) missense probably benign 0.18
R5718:Pkhd1l1 UTSW 15 44,408,813 (GRCm39) missense probably damaging 1.00
R5809:Pkhd1l1 UTSW 15 44,383,103 (GRCm39) missense probably benign 0.03
R5816:Pkhd1l1 UTSW 15 44,429,718 (GRCm39) missense probably benign 0.01
R5854:Pkhd1l1 UTSW 15 44,445,186 (GRCm39) missense probably damaging 1.00
R5876:Pkhd1l1 UTSW 15 44,441,984 (GRCm39) missense possibly damaging 0.51
R5909:Pkhd1l1 UTSW 15 44,390,159 (GRCm39) missense probably damaging 1.00
R5950:Pkhd1l1 UTSW 15 44,396,361 (GRCm39) missense probably benign 0.00
R5961:Pkhd1l1 UTSW 15 44,322,859 (GRCm39) missense probably damaging 1.00
R5972:Pkhd1l1 UTSW 15 44,408,812 (GRCm39) missense probably damaging 1.00
R5975:Pkhd1l1 UTSW 15 44,389,384 (GRCm39) missense probably damaging 1.00
R5982:Pkhd1l1 UTSW 15 44,352,900 (GRCm39) splice site probably null
R6066:Pkhd1l1 UTSW 15 44,391,525 (GRCm39) missense probably damaging 0.99
R6122:Pkhd1l1 UTSW 15 44,421,336 (GRCm39) missense probably damaging 1.00
R6248:Pkhd1l1 UTSW 15 44,392,955 (GRCm39) missense probably benign
R6294:Pkhd1l1 UTSW 15 44,433,424 (GRCm39) missense probably damaging 1.00
R6301:Pkhd1l1 UTSW 15 44,452,921 (GRCm39) missense probably damaging 0.99
R6526:Pkhd1l1 UTSW 15 44,361,485 (GRCm39) critical splice donor site probably null
R6707:Pkhd1l1 UTSW 15 44,392,539 (GRCm39) missense probably benign
R6736:Pkhd1l1 UTSW 15 44,421,336 (GRCm39) missense probably damaging 1.00
R6753:Pkhd1l1 UTSW 15 44,453,059 (GRCm39) missense probably benign 0.45
R6815:Pkhd1l1 UTSW 15 44,426,051 (GRCm39) missense probably damaging 1.00
R6874:Pkhd1l1 UTSW 15 44,452,923 (GRCm39) missense probably benign 0.06
R6942:Pkhd1l1 UTSW 15 44,386,025 (GRCm39) missense probably damaging 1.00
R6970:Pkhd1l1 UTSW 15 44,375,070 (GRCm39) missense possibly damaging 0.61
R6982:Pkhd1l1 UTSW 15 44,429,664 (GRCm39) missense probably damaging 0.97
R7103:Pkhd1l1 UTSW 15 44,437,027 (GRCm39) missense probably benign 0.02
R7116:Pkhd1l1 UTSW 15 44,421,372 (GRCm39) missense probably benign 0.00
R7135:Pkhd1l1 UTSW 15 44,448,374 (GRCm39) critical splice donor site probably null
R7143:Pkhd1l1 UTSW 15 44,437,033 (GRCm39) missense possibly damaging 0.93
R7177:Pkhd1l1 UTSW 15 44,330,800 (GRCm39) missense probably damaging 1.00
R7194:Pkhd1l1 UTSW 15 44,392,512 (GRCm39) missense probably damaging 1.00
R7204:Pkhd1l1 UTSW 15 44,386,949 (GRCm39) missense possibly damaging 0.90
R7215:Pkhd1l1 UTSW 15 44,391,559 (GRCm39) missense possibly damaging 0.78
R7218:Pkhd1l1 UTSW 15 44,386,091 (GRCm39) missense possibly damaging 0.49
R7225:Pkhd1l1 UTSW 15 44,410,337 (GRCm39) missense probably damaging 1.00
R7283:Pkhd1l1 UTSW 15 44,366,676 (GRCm39) missense probably benign 0.10
R7292:Pkhd1l1 UTSW 15 44,361,986 (GRCm39) missense probably benign
R7304:Pkhd1l1 UTSW 15 44,361,878 (GRCm39) missense possibly damaging 0.94
R7349:Pkhd1l1 UTSW 15 44,378,350 (GRCm39) missense probably damaging 1.00
R7359:Pkhd1l1 UTSW 15 44,452,882 (GRCm39) missense probably damaging 1.00
R7407:Pkhd1l1 UTSW 15 44,458,407 (GRCm39) missense possibly damaging 0.75
R7475:Pkhd1l1 UTSW 15 44,368,581 (GRCm39) nonsense probably null
R7481:Pkhd1l1 UTSW 15 44,376,307 (GRCm39) missense probably benign
R7554:Pkhd1l1 UTSW 15 44,358,866 (GRCm39) missense probably damaging 1.00
R7555:Pkhd1l1 UTSW 15 44,414,157 (GRCm39) missense possibly damaging 0.51
R7562:Pkhd1l1 UTSW 15 44,378,326 (GRCm39) missense possibly damaging 0.68
R7583:Pkhd1l1 UTSW 15 44,431,760 (GRCm39) critical splice donor site probably null
R7595:Pkhd1l1 UTSW 15 44,358,917 (GRCm39) missense probably damaging 1.00
R7749:Pkhd1l1 UTSW 15 44,391,133 (GRCm39) missense probably benign 0.00
R7754:Pkhd1l1 UTSW 15 44,449,804 (GRCm39) missense possibly damaging 0.94
R7761:Pkhd1l1 UTSW 15 44,393,280 (GRCm39) missense probably benign 0.00
R7774:Pkhd1l1 UTSW 15 44,404,303 (GRCm39) missense probably benign 0.03
R7785:Pkhd1l1 UTSW 15 44,406,965 (GRCm39) missense probably damaging 1.00
R7790:Pkhd1l1 UTSW 15 44,441,977 (GRCm39) missense probably damaging 1.00
R7804:Pkhd1l1 UTSW 15 44,460,534 (GRCm39) nonsense probably null
R7864:Pkhd1l1 UTSW 15 44,389,449 (GRCm39) critical splice donor site probably null
R7883:Pkhd1l1 UTSW 15 44,392,522 (GRCm39) missense probably damaging 1.00
R8031:Pkhd1l1 UTSW 15 44,376,230 (GRCm39) missense probably damaging 1.00
R8128:Pkhd1l1 UTSW 15 44,361,449 (GRCm39) missense possibly damaging 0.94
R8142:Pkhd1l1 UTSW 15 44,378,327 (GRCm39) missense probably benign 0.00
R8150:Pkhd1l1 UTSW 15 44,410,055 (GRCm39) missense possibly damaging 0.68
R8209:Pkhd1l1 UTSW 15 44,437,803 (GRCm39) missense possibly damaging 0.46
R8212:Pkhd1l1 UTSW 15 44,362,696 (GRCm39) missense probably benign 0.12
R8226:Pkhd1l1 UTSW 15 44,437,803 (GRCm39) missense possibly damaging 0.46
R8248:Pkhd1l1 UTSW 15 44,406,942 (GRCm39) missense probably damaging 0.99
R8299:Pkhd1l1 UTSW 15 44,445,330 (GRCm39) missense probably benign 0.26
R8425:Pkhd1l1 UTSW 15 44,437,911 (GRCm39) missense probably benign 0.01
R8485:Pkhd1l1 UTSW 15 44,423,796 (GRCm39) missense probably damaging 0.98
R8486:Pkhd1l1 UTSW 15 44,410,812 (GRCm39) missense probably damaging 1.00
R8701:Pkhd1l1 UTSW 15 44,438,079 (GRCm39) missense probably damaging 1.00
R8777:Pkhd1l1 UTSW 15 44,361,967 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Pkhd1l1 UTSW 15 44,361,967 (GRCm39) missense probably damaging 1.00
R8845:Pkhd1l1 UTSW 15 44,368,650 (GRCm39) missense probably benign 0.30
R8846:Pkhd1l1 UTSW 15 44,410,358 (GRCm39) nonsense probably null
R8863:Pkhd1l1 UTSW 15 44,433,382 (GRCm39) nonsense probably null
R8917:Pkhd1l1 UTSW 15 44,396,403 (GRCm39) missense probably benign 0.04
R8936:Pkhd1l1 UTSW 15 44,402,312 (GRCm39) missense possibly damaging 0.94
R8962:Pkhd1l1 UTSW 15 44,400,291 (GRCm39) missense probably damaging 1.00
R8971:Pkhd1l1 UTSW 15 44,392,915 (GRCm39) missense possibly damaging 0.68
R8973:Pkhd1l1 UTSW 15 44,449,833 (GRCm39) missense probably damaging 1.00
R8982:Pkhd1l1 UTSW 15 44,387,069 (GRCm39) nonsense probably null
R8994:Pkhd1l1 UTSW 15 44,410,499 (GRCm39) missense probably damaging 0.99
R9004:Pkhd1l1 UTSW 15 44,406,768 (GRCm39) missense probably benign 0.16
R9064:Pkhd1l1 UTSW 15 44,426,038 (GRCm39) missense possibly damaging 0.93
R9173:Pkhd1l1 UTSW 15 44,384,152 (GRCm39) missense probably benign 0.09
R9185:Pkhd1l1 UTSW 15 44,453,019 (GRCm39) missense probably benign 0.01
R9213:Pkhd1l1 UTSW 15 44,358,874 (GRCm39) missense probably damaging 1.00
R9218:Pkhd1l1 UTSW 15 44,384,122 (GRCm39) missense possibly damaging 0.90
R9256:Pkhd1l1 UTSW 15 44,397,290 (GRCm39) critical splice donor site probably null
R9291:Pkhd1l1 UTSW 15 44,433,372 (GRCm39) missense probably damaging 1.00
R9309:Pkhd1l1 UTSW 15 44,400,289 (GRCm39) missense probably benign 0.00
R9319:Pkhd1l1 UTSW 15 44,392,974 (GRCm39) missense possibly damaging 0.46
R9339:Pkhd1l1 UTSW 15 44,452,949 (GRCm39) missense probably damaging 1.00
R9366:Pkhd1l1 UTSW 15 44,410,308 (GRCm39) missense probably benign 0.03
R9444:Pkhd1l1 UTSW 15 44,418,053 (GRCm39) missense probably benign 0.00
R9464:Pkhd1l1 UTSW 15 44,343,009 (GRCm39) missense probably damaging 1.00
R9525:Pkhd1l1 UTSW 15 44,448,322 (GRCm39) missense possibly damaging 0.88
R9542:Pkhd1l1 UTSW 15 44,410,284 (GRCm39) missense probably benign 0.12
R9544:Pkhd1l1 UTSW 15 44,410,239 (GRCm39) missense probably damaging 1.00
R9608:Pkhd1l1 UTSW 15 44,442,029 (GRCm39) missense possibly damaging 0.65
R9673:Pkhd1l1 UTSW 15 44,386,901 (GRCm39) missense probably benign 0.22
R9771:Pkhd1l1 UTSW 15 44,358,883 (GRCm39) missense probably benign
R9792:Pkhd1l1 UTSW 15 44,406,983 (GRCm39) missense probably benign 0.00
R9793:Pkhd1l1 UTSW 15 44,406,983 (GRCm39) missense probably benign 0.00
R9795:Pkhd1l1 UTSW 15 44,406,983 (GRCm39) missense probably benign 0.00
RF006:Pkhd1l1 UTSW 15 44,421,903 (GRCm39) critical splice acceptor site probably benign
RF006:Pkhd1l1 UTSW 15 44,366,634 (GRCm39) missense probably benign 0.03
RF008:Pkhd1l1 UTSW 15 44,421,901 (GRCm39) critical splice acceptor site probably benign
RF012:Pkhd1l1 UTSW 15 44,421,901 (GRCm39) critical splice acceptor site probably benign
RF019:Pkhd1l1 UTSW 15 44,421,903 (GRCm39) critical splice acceptor site probably benign
RF030:Pkhd1l1 UTSW 15 44,421,898 (GRCm39) critical splice acceptor site probably benign
RF033:Pkhd1l1 UTSW 15 44,421,902 (GRCm39) critical splice acceptor site probably benign
RF038:Pkhd1l1 UTSW 15 44,421,899 (GRCm39) critical splice acceptor site probably benign
RF046:Pkhd1l1 UTSW 15 44,421,891 (GRCm39) critical splice acceptor site probably benign
X0027:Pkhd1l1 UTSW 15 44,455,362 (GRCm39) missense probably damaging 0.99
Z1177:Pkhd1l1 UTSW 15 44,441,974 (GRCm39) missense probably damaging 0.99
Z1177:Pkhd1l1 UTSW 15 44,436,972 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCCAAACACATGTGTCTTTTC -3'
(R):5'- AGACCAGGTTGCTAATTTCATGG -3'

Sequencing Primer
(F):5'- AAACACATGTGTCTTTTCTCTCTG -3'
(R):5'- CCAGGTTGCTAATTTCATGGCTCTG -3'
Posted On 2021-04-30