Incidental Mutation 'R8710:Wdfy3'
ID 669489
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene Name WD repeat and FYVE domain containing 3
Synonyms D5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.943) question?
Stock # R8710 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 101832956-102069921 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 101882483 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 2386 (N2386K)
Ref Sequence ENSEMBL: ENSMUSP00000052607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000212024]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000053177
AA Change: N2386K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: N2386K

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174598
AA Change: N2386K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: N2386K

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212024
AA Change: N2372K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030025P20Rik A T 17: 14,988,932 N342I probably damaging Het
Abcb4 A G 5: 8,955,495 N1126S probably damaging Het
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Agpat5 T A 8: 18,878,089 D223E possibly damaging Het
Anks3 A C 16: 4,958,112 Y75* probably null Het
Ano5 T G 7: 51,593,671 D847E probably damaging Het
Asb6 G T 2: 30,827,060 T51K probably benign Het
Bahcc1 A G 11: 120,284,127 E1702G probably damaging Het
Bend7 A G 2: 4,763,114 M294V probably benign Het
Cadm1 T A 9: 47,848,168 D392E probably damaging Het
Camkmt T C 17: 85,113,849 probably benign Het
Cd300a A G 11: 114,894,675 T149A probably benign Het
Cd69 A T 6: 129,269,610 W153R possibly damaging Het
Cdc25c T A 18: 34,749,613 probably benign Het
Clnk A C 5: 38,774,597 C40W possibly damaging Het
Cthrc1 T A 15: 39,084,426 L180Q probably damaging Het
Cyld A G 8: 88,709,895 N271S probably damaging Het
Dnah14 T C 1: 181,690,311 I2070T probably benign Het
Dnah17 A C 11: 118,042,147 L3595R probably damaging Het
Edrf1 A G 7: 133,643,766 Y211C probably damaging Het
Efcab6 A G 15: 84,018,648 I167T probably benign Het
Elavl3 A T 9: 22,026,553 Y148N probably damaging Het
Fam83c A G 2: 155,829,722 S598P probably benign Het
Gm38119 ACTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTACTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACA ACTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTACTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACA 3: 92,737,890 probably benign Het
Helb A G 10: 120,105,967 L272P probably damaging Het
Iars2 A C 1: 185,295,586 V715G probably benign Het
Iqgap2 T G 13: 95,660,248 N1133H probably benign Het
Kifc5b T A 17: 26,920,906 M43K probably damaging Het
Krtap7-1 T A 16: 89,508,120 Y48F possibly damaging Het
Lag3 G A 6: 124,908,445 T324I probably damaging Het
Mapkapk2 C A 1: 131,058,711 A97S possibly damaging Het
Mettl4 A G 17: 94,733,644 S361P probably damaging Het
Myh4 A G 11: 67,252,332 T1029A probably benign Het
Nsl1 C A 1: 191,063,223 A62D probably benign Het
Oas1e T A 5: 120,791,962 K164* probably null Het
Obsl1 A G 1: 75,492,682 F1205S probably benign Het
Olfr113 G T 17: 37,574,649 A258E probably benign Het
Olfr1537 T A 9: 39,238,010 Y138F probably benign Het
Olfr22-ps1 G A 11: 73,954,868 M59I possibly damaging Het
Olfr893 C T 9: 38,209,770 A237V possibly damaging Het
Pald1 A G 10: 61,347,453 F334S probably benign Het
Pikfyve A G 1: 65,215,996 E325G possibly damaging Het
Plekha8 A G 6: 54,622,260 T215A probably benign Het
Ptprq T C 10: 107,576,058 R1816G possibly damaging Het
Ralgps1 G A 2: 33,145,421 L472F probably damaging Het
Rasal1 A T 5: 120,662,937 T221S probably benign Het
Rfx6 A G 10: 51,725,405 T607A probably damaging Het
Rnf214 T A 9: 45,867,450 probably benign Het
Rtca A T 3: 116,497,654 Y226N probably benign Het
Sash1 T A 10: 8,780,521 N236Y possibly damaging Het
Skint11 A G 4: 114,194,754 I100V probably benign Het
Skint5 A T 4: 113,626,590 S948R unknown Het
Slc25a13 A T 6: 6,114,238 Y279N probably benign Het
Slc5a2 T C 7: 128,265,794 L33P probably damaging Het
Slco1a5 A T 6: 142,253,102 V279E probably benign Het
Ssh3 G T 19: 4,263,805 H475Q probably benign Het
Tapt1 A G 5: 44,194,401 S107P probably benign Het
Tjp2 T C 19: 24,095,432 E1166G probably damaging Het
Tll1 A G 8: 64,124,906 L89P possibly damaging Het
Tmc4 G T 7: 3,675,464 T123N probably benign Het
Tmem139 A G 6: 42,264,087 D202G probably damaging Het
Trim35 T C 14: 66,307,918 S313P probably damaging Het
Ttc23l A G 15: 10,539,935 I154T probably damaging Het
Ttc9c T C 19: 8,818,496 T60A probably benign Het
Wdpcp C A 11: 21,660,924 Q49K probably benign Het
Xrn1 A T 9: 96,002,232 Y867F Het
Zfp423 C T 8: 87,780,921 E932K possibly damaging Het
Zfp592 T C 7: 81,023,573 F95S probably damaging Het
Zfp644 T G 5: 106,635,131 N1095H probably damaging Het
Zfp983 A T 17: 21,661,318 N54I probably damaging Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 101915338 critical splice donor site probably null
IGL00567:Wdfy3 APN 5 101912030 splice site probably benign
IGL01288:Wdfy3 APN 5 101901991 splice site probably null
IGL01323:Wdfy3 APN 5 101895064 missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 101944120 missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 101900031 missense probably benign
IGL01560:Wdfy3 APN 5 101957486 nonsense probably null
IGL01566:Wdfy3 APN 5 101896588 splice site probably benign
IGL01616:Wdfy3 APN 5 101913260 missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 101907488 missense probably benign
IGL01791:Wdfy3 APN 5 101937412 missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 101924081 missense probably benign 0.11
IGL01953:Wdfy3 APN 5 101895028 nonsense probably null
IGL02121:Wdfy3 APN 5 101898510 missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 101961157 missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 101922609 missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 101888192 missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 101896475 missense probably benign 0.37
IGL02801:Wdfy3 APN 5 101907587 missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 101968920 missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 101855471 missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 101894912 missense probably null 1.00
IGL03064:Wdfy3 APN 5 101935997 missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 101866276 missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101844912 splice site probably benign
IGL03237:Wdfy3 APN 5 101844599 missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 101900150 missense probably damaging 1.00
Esurient UTSW 5 101944103 missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 101929981 missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 101882961 frame shift probably null
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101845046 missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 101889295 missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101844614 missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 101888105 missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0148:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0279:Wdfy3 UTSW 5 101868092 missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 101948966 missense probably damaging 0.99
R0472:Wdfy3 UTSW 5 101957443 missense probably benign 0.13
R0513:Wdfy3 UTSW 5 101890789 missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 101906185 missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101836172 missense probably benign
R0787:Wdfy3 UTSW 5 101957388 missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 101870051 missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 101882966 missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 101875931 missense probably benign
R1350:Wdfy3 UTSW 5 101898552 missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 101884214 splice site probably benign
R1446:Wdfy3 UTSW 5 101851310 missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 101937738 missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 101917579 missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101844081 missense probably benign
R1633:Wdfy3 UTSW 5 101981548 missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 101875915 missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 101941447 missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 101926525 frame shift probably null
R1743:Wdfy3 UTSW 5 101844065 missense probably benign 0.12
R1745:Wdfy3 UTSW 5 101948929 missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 101894999 missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 101915376 missense probably benign 0.00
R1854:Wdfy3 UTSW 5 101888186 missense probably benign 0.05
R1880:Wdfy3 UTSW 5 101917435 missense probably benign 0.05
R1930:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 101919409 missense probably benign 0.30
R1965:Wdfy3 UTSW 5 101951312 missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 101860486 missense probably null 1.00
R2087:Wdfy3 UTSW 5 101895060 missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 101898425 critical splice donor site probably null
R2192:Wdfy3 UTSW 5 101907542 missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 101889284 missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 101888323 splice site probably benign
R2406:Wdfy3 UTSW 5 101888259 missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 101875930 missense probably benign 0.04
R2937:Wdfy3 UTSW 5 101944122 missense probably benign 0.07
R3765:Wdfy3 UTSW 5 101861400 missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 101937600 missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 101944239 nonsense probably null
R3947:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 101924095 splice site probably benign
R4065:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4066:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4110:Wdfy3 UTSW 5 101900058 critical splice donor site probably null
R4235:Wdfy3 UTSW 5 101922634 critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 101910984 missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 101906145 missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 101884083 missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 101943934 missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 101930028 missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 101943943 missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 101894921 missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 101948972 nonsense probably null
R4973:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4976:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4984:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4986:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R5068:Wdfy3 UTSW 5 101894937 missense probably benign 0.15
R5105:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 101868106 missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 101944103 missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101849267 critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101847106 missense probably null 0.03
R5303:Wdfy3 UTSW 5 101952983 missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 101872858 missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 101919446 missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 101896559 missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101836274 missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 101861448 missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 101869989 missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 101884138 missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101851359 missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101849423 missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 101898429 missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 101913179 missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 101953166 missense probably benign 0.19
R6776:Wdfy3 UTSW 5 101884045 missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 101917431 nonsense probably null
R6809:Wdfy3 UTSW 5 101923947 missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 101952999 missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101844066 missense probably benign 0.10
R7014:Wdfy3 UTSW 5 101894909 critical splice donor site probably null
R7034:Wdfy3 UTSW 5 101907518 missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 101915437 missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 101943892 missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 101901919 missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101836208 missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 101855523 missense probably benign 0.02
R7418:Wdfy3 UTSW 5 101957500 missense probably benign 0.08
R7533:Wdfy3 UTSW 5 101882488 missense probably benign 0.27
R7543:Wdfy3 UTSW 5 101936059 missense probably benign 0.00
R7625:Wdfy3 UTSW 5 101855386 splice site probably null
R7788:Wdfy3 UTSW 5 101848357 missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 101895074 missense probably benign 0.01
R7810:Wdfy3 UTSW 5 101951399 nonsense probably null
R8204:Wdfy3 UTSW 5 101852585 missense probably benign 0.00
R8268:Wdfy3 UTSW 5 101941610 missense probably damaging 1.00
R8286:Wdfy3 UTSW 5 101937421 missense probably benign
R8507:Wdfy3 UTSW 5 101872901 missense probably benign 0.05
R8514:Wdfy3 UTSW 5 101851353 missense possibly damaging 0.92
R8536:Wdfy3 UTSW 5 101885198 missense probably benign
R8735:Wdfy3 UTSW 5 101930085 missense probably benign 0.00
R8749:Wdfy3 UTSW 5 101882580 missense probably damaging 1.00
R8931:Wdfy3 UTSW 5 101917555 missense probably benign 0.11
R8943:Wdfy3 UTSW 5 101845365 intron probably benign
R8968:Wdfy3 UTSW 5 101864117 missense probably benign 0.05
R8979:Wdfy3 UTSW 5 101948898 missense probably damaging 1.00
R8998:Wdfy3 UTSW 5 101845192 missense probably benign 0.05
R9045:Wdfy3 UTSW 5 101847174 missense probably damaging 1.00
R9068:Wdfy3 UTSW 5 101852585 missense probably benign 0.34
R9105:Wdfy3 UTSW 5 101882646 missense probably benign 0.05
R9122:Wdfy3 UTSW 5 101943965 missense probably damaging 1.00
R9209:Wdfy3 UTSW 5 101930964 missense probably benign 0.01
R9249:Wdfy3 UTSW 5 101848493 missense possibly damaging 0.82
R9348:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R9481:Wdfy3 UTSW 5 101852612 missense probably benign 0.19
R9490:Wdfy3 UTSW 5 101930850 missense probably benign 0.29
R9524:Wdfy3 UTSW 5 101907467 missense probably benign 0.03
R9545:Wdfy3 UTSW 5 101953091 missense
R9548:Wdfy3 UTSW 5 101885193 missense probably damaging 0.99
R9636:Wdfy3 UTSW 5 101900033 missense probably benign
R9750:Wdfy3 UTSW 5 101930094 missense probably benign 0.00
R9766:Wdfy3 UTSW 5 101895000 missense possibly damaging 0.90
R9771:Wdfy3 UTSW 5 101852329 missense probably damaging 1.00
Z1177:Wdfy3 UTSW 5 101900241 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CAGAGTCTATGTTCTATGCCTGC -3'
(R):5'- GCCCTTCTGTTGTTGAGAAGC -3'

Sequencing Primer
(F):5'- CTCAGGGTGACGTCACTAGTTAC -3'
(R):5'- CTGTTGTTGAGAAGCCAACC -3'
Posted On 2021-04-30