Incidental Mutation 'R8710:Zfp592'
ID 669501
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Name zinc finger protein 592
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.934) question?
Stock # R8710 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80993681-81045164 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81023573 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 95 (F95S)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
AlphaFold Q8BHZ4
Predicted Effect probably damaging
Transcript: ENSMUST00000107353
AA Change: F95S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: F95S

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030025P20Rik A T 17: 14,988,932 N342I probably damaging Het
Abcb4 A G 5: 8,955,495 N1126S probably damaging Het
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Agpat5 T A 8: 18,878,089 D223E possibly damaging Het
Anks3 A C 16: 4,958,112 Y75* probably null Het
Ano5 T G 7: 51,593,671 D847E probably damaging Het
Asb6 G T 2: 30,827,060 T51K probably benign Het
Bahcc1 A G 11: 120,284,127 E1702G probably damaging Het
Bend7 A G 2: 4,763,114 M294V probably benign Het
Cadm1 T A 9: 47,848,168 D392E probably damaging Het
Camkmt T C 17: 85,113,849 probably benign Het
Cd300a A G 11: 114,894,675 T149A probably benign Het
Cd69 A T 6: 129,269,610 W153R possibly damaging Het
Cdc25c T A 18: 34,749,613 probably benign Het
Clnk A C 5: 38,774,597 C40W possibly damaging Het
Cthrc1 T A 15: 39,084,426 L180Q probably damaging Het
Cyld A G 8: 88,709,895 N271S probably damaging Het
Dnah14 T C 1: 181,690,311 I2070T probably benign Het
Dnah17 A C 11: 118,042,147 L3595R probably damaging Het
Edrf1 A G 7: 133,643,766 Y211C probably damaging Het
Efcab6 A G 15: 84,018,648 I167T probably benign Het
Elavl3 A T 9: 22,026,553 Y148N probably damaging Het
Fam83c A G 2: 155,829,722 S598P probably benign Het
Gm38119 ACTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTACTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACA ACTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTACTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACA 3: 92,737,890 probably benign Het
Helb A G 10: 120,105,967 L272P probably damaging Het
Iars2 A C 1: 185,295,586 V715G probably benign Het
Iqgap2 T G 13: 95,660,248 N1133H probably benign Het
Kifc5b T A 17: 26,920,906 M43K probably damaging Het
Krtap7-1 T A 16: 89,508,120 Y48F possibly damaging Het
Lag3 G A 6: 124,908,445 T324I probably damaging Het
Mapkapk2 C A 1: 131,058,711 A97S possibly damaging Het
Mettl4 A G 17: 94,733,644 S361P probably damaging Het
Myh4 A G 11: 67,252,332 T1029A probably benign Het
Nsl1 C A 1: 191,063,223 A62D probably benign Het
Oas1e T A 5: 120,791,962 K164* probably null Het
Obsl1 A G 1: 75,492,682 F1205S probably benign Het
Olfr113 G T 17: 37,574,649 A258E probably benign Het
Olfr1537 T A 9: 39,238,010 Y138F probably benign Het
Olfr22-ps1 G A 11: 73,954,868 M59I possibly damaging Het
Olfr893 C T 9: 38,209,770 A237V possibly damaging Het
Pald1 A G 10: 61,347,453 F334S probably benign Het
Pikfyve A G 1: 65,215,996 E325G possibly damaging Het
Plekha8 A G 6: 54,622,260 T215A probably benign Het
Ptprq T C 10: 107,576,058 R1816G possibly damaging Het
Ralgps1 G A 2: 33,145,421 L472F probably damaging Het
Rasal1 A T 5: 120,662,937 T221S probably benign Het
Rfx6 A G 10: 51,725,405 T607A probably damaging Het
Rnf214 T A 9: 45,867,450 probably benign Het
Rtca A T 3: 116,497,654 Y226N probably benign Het
Sash1 T A 10: 8,780,521 N236Y possibly damaging Het
Skint11 A G 4: 114,194,754 I100V probably benign Het
Skint5 A T 4: 113,626,590 S948R unknown Het
Slc25a13 A T 6: 6,114,238 Y279N probably benign Het
Slc5a2 T C 7: 128,265,794 L33P probably damaging Het
Slco1a5 A T 6: 142,253,102 V279E probably benign Het
Ssh3 G T 19: 4,263,805 H475Q probably benign Het
Tapt1 A G 5: 44,194,401 S107P probably benign Het
Tjp2 T C 19: 24,095,432 E1166G probably damaging Het
Tll1 A G 8: 64,124,906 L89P possibly damaging Het
Tmc4 G T 7: 3,675,464 T123N probably benign Het
Tmem139 A G 6: 42,264,087 D202G probably damaging Het
Trim35 T C 14: 66,307,918 S313P probably damaging Het
Ttc23l A G 15: 10,539,935 I154T probably damaging Het
Ttc9c T C 19: 8,818,496 T60A probably benign Het
Wdfy3 G T 5: 101,882,483 N2386K probably damaging Het
Wdpcp C A 11: 21,660,924 Q49K probably benign Het
Xrn1 A T 9: 96,002,232 Y867F Het
Zfp423 C T 8: 87,780,921 E932K possibly damaging Het
Zfp644 T G 5: 106,635,131 N1095H probably damaging Het
Zfp983 A T 17: 21,661,318 N54I probably damaging Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 81041548 nonsense probably null
IGL01984:Zfp592 APN 7 81038644 missense probably benign 0.00
IGL02079:Zfp592 APN 7 81039230 missense probably benign 0.20
IGL02096:Zfp592 APN 7 81025048 missense probably damaging 1.00
IGL02125:Zfp592 APN 7 81038184 missense probably benign 0.00
IGL02374:Zfp592 APN 7 81024983 missense probably damaging 1.00
IGL02419:Zfp592 APN 7 81038245 missense probably damaging 1.00
IGL02466:Zfp592 APN 7 81023998 missense probably damaging 1.00
IGL02485:Zfp592 APN 7 81037970 splice site probably benign
IGL02500:Zfp592 APN 7 81041726 missense probably benign
IGL02876:Zfp592 APN 7 81038127 missense probably benign 0.01
IGL02940:Zfp592 APN 7 81024827 missense probably damaging 1.00
R0326:Zfp592 UTSW 7 81024889 missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 81038071 missense probably damaging 1.00
R0684:Zfp592 UTSW 7 81037875 missense probably benign 0.00
R0750:Zfp592 UTSW 7 81024745 missense probably benign
R1346:Zfp592 UTSW 7 81038064 missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 81024479 missense probably damaging 0.99
R1650:Zfp592 UTSW 7 81038100 missense probably benign 0.04
R1804:Zfp592 UTSW 7 81023695 missense probably damaging 1.00
R1918:Zfp592 UTSW 7 81037420 nonsense probably null
R2114:Zfp592 UTSW 7 81024796 missense probably damaging 1.00
R2144:Zfp592 UTSW 7 81038202 missense probably benign 0.01
R2164:Zfp592 UTSW 7 81041438 missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 81041613 missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 81037411 nonsense probably null
R3809:Zfp592 UTSW 7 81024532 missense probably benign 0.00
R4574:Zfp592 UTSW 7 81023786 missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 81041859 missense probably damaging 1.00
R5023:Zfp592 UTSW 7 81024347 missense probably damaging 1.00
R5121:Zfp592 UTSW 7 81023561 missense probably damaging 1.00
R5174:Zfp592 UTSW 7 81038325 missense probably damaging 1.00
R5794:Zfp592 UTSW 7 81025033 missense probably benign 0.00
R5946:Zfp592 UTSW 7 81037897 missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 81023436 missense probably benign 0.05
R6657:Zfp592 UTSW 7 81025486 missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R6872:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R7056:Zfp592 UTSW 7 81023319 missense probably damaging 1.00
R7295:Zfp592 UTSW 7 81024322 missense probably damaging 1.00
R7351:Zfp592 UTSW 7 81041691 missense probably benign 0.00
R7475:Zfp592 UTSW 7 81023452 missense probably damaging 0.99
R7509:Zfp592 UTSW 7 81038340 missense probably damaging 0.99
R7552:Zfp592 UTSW 7 81023642 missense probably benign 0.01
R7737:Zfp592 UTSW 7 81025193 missense probably damaging 1.00
R7752:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R7901:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R8100:Zfp592 UTSW 7 81024192 missense probably benign 0.05
R8440:Zfp592 UTSW 7 81041523 missense possibly damaging 0.89
R8766:Zfp592 UTSW 7 81024605 missense probably benign 0.00
R9083:Zfp592 UTSW 7 81024896 missense possibly damaging 0.95
R9141:Zfp592 UTSW 7 81024457 missense probably damaging 1.00
R9194:Zfp592 UTSW 7 81024601 missense probably benign
R9197:Zfp592 UTSW 7 81024319 missense possibly damaging 0.73
R9246:Zfp592 UTSW 7 81041781 missense probably benign 0.03
R9321:Zfp592 UTSW 7 81041478 missense possibly damaging 0.65
R9426:Zfp592 UTSW 7 81024457 missense probably damaging 1.00
R9785:Zfp592 UTSW 7 81023497 missense probably damaging 1.00
X0022:Zfp592 UTSW 7 81038187 nonsense probably null
X0028:Zfp592 UTSW 7 81024014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTTGATGCAAAGGAGGC -3'
(R):5'- TATCTTTGACAGGATCCTCAGGC -3'

Sequencing Primer
(F):5'- ATCCAGGCTCCCAGTGAG -3'
(R):5'- ACAGGATCCTCAGGCTCTGG -3'
Posted On 2021-04-30