Incidental Mutation 'R8710:Edrf1'
ID669503
Institutional Source Beutler Lab
Gene Symbol Edrf1
Ensembl Gene ENSMUSG00000039990
Gene Nameerythroid differentiation regulatory factor 1
Synonyms2700050L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R8710 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location133637543-133672971 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133643766 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 211 (Y211C)
Ref Sequence ENSEMBL: ENSMUSP00000059166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051169] [ENSMUST00000128901]
Predicted Effect probably damaging
Transcript: ENSMUST00000051169
AA Change: Y211C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059166
Gene: ENSMUSG00000039990
AA Change: Y211C

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1229 1237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128901
AA Change: Y211C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115641
Gene: ENSMUSG00000039990
AA Change: Y211C

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 1137 1150 N/A INTRINSIC
low complexity region 1195 1203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in erythroid cell differentiation. The encoded protein inhibits DNA binding of the erythroid transcription factor GATA-1 and may regulate the expression of alpha-globin and gamma-globin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030025P20Rik A T 17: 14,988,932 N342I probably damaging Het
Abcb4 A G 5: 8,955,495 N1126S probably damaging Het
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Agpat5 T A 8: 18,878,089 D223E possibly damaging Het
Anks3 A C 16: 4,958,112 Y75* probably null Het
Ano5 T G 7: 51,593,671 D847E probably damaging Het
Asb6 G T 2: 30,827,060 T51K probably benign Het
Bahcc1 A G 11: 120,284,127 E1702G probably damaging Het
Bend7 A G 2: 4,763,114 M294V probably benign Het
Cadm1 T A 9: 47,848,168 D392E probably damaging Het
Camkmt T C 17: 85,113,849 probably benign Het
Cd300a A G 11: 114,894,675 T149A probably benign Het
Cd69 A T 6: 129,269,610 W153R possibly damaging Het
Cdc25c T A 18: 34,749,613 probably benign Het
Clnk A C 5: 38,774,597 C40W possibly damaging Het
Cthrc1 T A 15: 39,084,426 L180Q probably damaging Het
Cyld A G 8: 88,709,895 N271S probably damaging Het
Dnah14 T C 1: 181,690,311 I2070T probably benign Het
Dnah17 A C 11: 118,042,147 L3595R probably damaging Het
Efcab6 A G 15: 84,018,648 I167T probably benign Het
Elavl3 A T 9: 22,026,553 Y148N probably damaging Het
Fam83c A G 2: 155,829,722 S598P probably benign Het
Gm38119 ACTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTACTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACA ACTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTACTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACA 3: 92,737,890 probably benign Het
Helb A G 10: 120,105,967 L272P probably damaging Het
Iars2 A C 1: 185,295,586 V715G probably benign Het
Iqgap2 T G 13: 95,660,248 N1133H probably benign Het
Kifc5b T A 17: 26,920,906 M43K probably damaging Het
Krtap7-1 T A 16: 89,508,120 Y48F possibly damaging Het
Lag3 G A 6: 124,908,445 T324I probably damaging Het
Mapkapk2 C A 1: 131,058,711 A97S possibly damaging Het
Mettl4 A G 17: 94,733,644 S361P probably damaging Het
Myh4 A G 11: 67,252,332 T1029A probably benign Het
Nsl1 C A 1: 191,063,223 A62D probably benign Het
Oas1e T A 5: 120,791,962 K164* probably null Het
Obsl1 A G 1: 75,492,682 F1205S probably benign Het
Olfr113 G T 17: 37,574,649 A258E probably benign Het
Olfr1537 T A 9: 39,238,010 Y138F probably benign Het
Olfr22-ps1 G A 11: 73,954,868 M59I possibly damaging Het
Olfr893 C T 9: 38,209,770 A237V possibly damaging Het
Pald1 A G 10: 61,347,453 F334S probably benign Het
Pikfyve A G 1: 65,215,996 E325G possibly damaging Het
Plekha8 A G 6: 54,622,260 T215A probably benign Het
Ptprq T C 10: 107,576,058 R1816G possibly damaging Het
Ralgps1 G A 2: 33,145,421 L472F probably damaging Het
Rasal1 A T 5: 120,662,937 T221S probably benign Het
Rfx6 A G 10: 51,725,405 T607A probably damaging Het
Rnf214 T A 9: 45,867,450 probably benign Het
Rtca A T 3: 116,497,654 Y226N probably benign Het
Sash1 T A 10: 8,780,521 N236Y possibly damaging Het
Skint11 A G 4: 114,194,754 I100V probably benign Het
Skint5 A T 4: 113,626,590 S948R unknown Het
Slc25a13 A T 6: 6,114,238 Y279N probably benign Het
Slc5a2 T C 7: 128,265,794 L33P probably damaging Het
Slco1a5 A T 6: 142,253,102 V279E probably benign Het
Ssh3 G T 19: 4,263,805 H475Q probably benign Het
Tapt1 A G 5: 44,194,401 S107P probably benign Het
Tjp2 T C 19: 24,095,432 E1166G probably damaging Het
Tll1 A G 8: 64,124,906 L89P possibly damaging Het
Tmc4 G T 7: 3,675,464 T123N probably benign Het
Tmem139 A G 6: 42,264,087 D202G probably damaging Het
Trim35 T C 14: 66,307,918 S313P probably damaging Het
Ttc23l A G 15: 10,539,935 I154T probably damaging Het
Ttc9c T C 19: 8,818,496 T60A probably benign Het
Wdfy3 G T 5: 101,882,483 N2386K probably damaging Het
Wdpcp C A 11: 21,660,924 Q49K probably benign Het
Xrn1 A T 9: 96,002,232 Y867F Het
Zfp423 C T 8: 87,780,921 E932K possibly damaging Het
Zfp592 T C 7: 81,023,573 F95S probably damaging Het
Zfp644 T G 5: 106,635,131 N1095H probably damaging Het
Zfp983 A T 17: 21,661,318 N54I probably damaging Het
Other mutations in Edrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Edrf1 APN 7 133658553 nonsense probably null
IGL01637:Edrf1 APN 7 133650525 missense probably damaging 1.00
IGL01697:Edrf1 APN 7 133643730 missense probably benign 0.02
IGL01893:Edrf1 APN 7 133657102 missense probably benign 0.09
IGL02202:Edrf1 APN 7 133656970 missense probably benign 0.00
IGL02278:Edrf1 APN 7 133657000 missense probably benign 0.00
IGL02382:Edrf1 APN 7 133650615 splice site probably benign
IGL02743:Edrf1 APN 7 133656491 unclassified probably benign
R0265:Edrf1 UTSW 7 133657045 missense probably damaging 1.00
R0282:Edrf1 UTSW 7 133644022 missense probably benign 0.21
R1167:Edrf1 UTSW 7 133644066 missense probably benign 0.08
R1633:Edrf1 UTSW 7 133652140 missense probably damaging 1.00
R2039:Edrf1 UTSW 7 133653949 nonsense probably null
R2060:Edrf1 UTSW 7 133657129 nonsense probably null
R2920:Edrf1 UTSW 7 133667572 missense probably benign 0.00
R4770:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4887:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4888:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5135:Edrf1 UTSW 7 133651044 missense probably benign 0.03
R5156:Edrf1 UTSW 7 133660179 missense probably damaging 1.00
R5290:Edrf1 UTSW 7 133650566 missense probably damaging 0.98
R5342:Edrf1 UTSW 7 133651910 splice site probably null
R5416:Edrf1 UTSW 7 133641402 missense possibly damaging 0.52
R5450:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5906:Edrf1 UTSW 7 133663415 missense probably benign
R6272:Edrf1 UTSW 7 133637808 start gained probably benign
R6275:Edrf1 UTSW 7 133667582 missense possibly damaging 0.60
R7144:Edrf1 UTSW 7 133637849 missense probably benign
R7244:Edrf1 UTSW 7 133654350 missense probably benign 0.01
R7716:Edrf1 UTSW 7 133643726 missense probably damaging 0.99
R8193:Edrf1 UTSW 7 133661877 missense possibly damaging 0.95
R8197:Edrf1 UTSW 7 133647359 missense probably benign 0.41
R8553:Edrf1 UTSW 7 133650318 missense possibly damaging 0.88
R8839:Edrf1 UTSW 7 133653915 missense probably benign 0.00
R9035:Edrf1 UTSW 7 133643702 missense probably damaging 0.97
R9051:Edrf1 UTSW 7 133671478 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTATTCATCACACGTGTGC -3'
(R):5'- TGATGCTAGTCAACCGGAAATAG -3'

Sequencing Primer
(F):5'- ATCACACGTGTGCATATTTGTTCG -3'
(R):5'- CAGCCTACCTGTCTGTATAAAACAG -3'
Posted On2021-04-30