Incidental Mutation 'R8711:Polr1b'
ID669552
Institutional Source Beutler Lab
Gene Symbol Polr1b
Ensembl Gene ENSMUSG00000027395
Gene Namepolymerase (RNA) I polypeptide B
Synonyms128kDa, RPA116, RPA2, D630020H17Rik, Rpo1-2
Accession Numbers

Ncbi RefSeq: NM_009086.2; MGI:108014

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8711 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location129100995-129126594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129101144 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 20 (T20A)
Ref Sequence ENSEMBL: ENSMUSP00000099494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028874] [ENSMUST00000035812] [ENSMUST00000103205]
Predicted Effect probably damaging
Transcript: ENSMUST00000028874
AA Change: T20A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028874
Gene: ENSMUSG00000027395
AA Change: T20A

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 437 4.6e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 8.9e-14 PFAM
Pfam:RNA_pol_Rpb2_3 455 521 1.4e-28 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035812
SMART Domains Protein: ENSMUSP00000046883
Gene: ENSMUSG00000027394

DomainStartEndE-ValueType
Pfam:TTL 54 367 1.2e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103205
AA Change: T20A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099494
Gene: ENSMUSG00000027395
AA Change: T20A

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 423 1.7e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 3.2e-11 PFAM
Pfam:RNA_pol_Rpb2_3 455 520 2.1e-29 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 4.1e-23 PFAM
Pfam:RNA_pol_Rpb2_6 670 1031 9.7e-118 PFAM
Pfam:RNA_pol_Rpb2_7 1033 1135 1.2e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 3774130
Lethality: E2-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic RNA polymerase I (pol I) is responsible for the transcription of ribosomal RNA (rRNA) genes and production of rRNA, the primary component of ribosomes. Pol I is a multisubunit enzyme composed of 6 to 14 polypeptides, depending on the species. Most of the mass of the pol I complex derives from the 2 largest subunits, Rpa1 and Rpa2 in yeast. POLR1B is homologous to Rpa2 (Seither and Grummt, 1996 [PubMed 8921381]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality prior to implantation. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,516,086 S122T probably benign Het
Abcb11 G A 2: 69,265,512 T828I probably damaging Het
Atp5b T A 10: 128,085,500 N222K probably damaging Het
C1qbp T C 11: 70,978,487 T211A probably benign Het
Ccdc85a A T 11: 28,434,146 S410T possibly damaging Het
Col10a1 G T 10: 34,394,828 K265N probably damaging Het
Cyp2j5 A T 4: 96,641,423 M237K possibly damaging Het
Cyp4f40 T C 17: 32,675,988 probably benign Het
Cytip A T 2: 58,151,123 F90L probably damaging Het
Dnah7b A G 1: 46,175,438 D1121G probably damaging Het
Dohh G T 10: 81,386,025 E84D probably benign Het
Eif4g2 T C 7: 111,073,920 Y855C probably damaging Het
Ell T A 8: 70,581,681 probably benign Het
Ermap T C 4: 119,187,158 Y147C probably damaging Het
Fasn T C 11: 120,819,118 D371G possibly damaging Het
Fat2 A G 11: 55,268,303 S3348P probably benign Het
Fhad1 T A 4: 141,957,613 N472Y probably benign Het
Flad1 A G 3: 89,409,108 V49A probably damaging Het
Fpr-rs3 T C 17: 20,624,292 T196A probably benign Het
Fsip2 A G 2: 82,984,902 N3660D possibly damaging Het
Gabrp T A 11: 33,555,023 L259F probably damaging Het
Gm11639 A G 11: 104,852,545 I2187V probably benign Het
Gm16686 A T 4: 88,755,236 W119R unknown Het
Gm17660 G A 5: 104,072,090 T78I unknown Het
Gm21319 T A 12: 87,773,360 D143V unknown Het
Gng2 C T 14: 19,891,370 M1I probably null Het
Hmgxb3 T C 18: 61,157,649 N384S probably benign Het
Ibtk T C 9: 85,724,155 I440V probably benign Het
Il11ra1 A G 4: 41,767,539 D297G probably damaging Het
Irf2bpl T C 12: 86,881,722 I726V probably benign Het
Klk1b5 A G 7: 44,218,572 N56S probably benign Het
Laptm4b T A 15: 34,277,502 V193E probably damaging Het
Lrrc37a A T 11: 103,497,524 C2358* probably null Het
Ltbp2 C T 12: 84,853,741 S269N probably benign Het
Morc2a T G 11: 3,680,013 Y450D probably damaging Het
Mycbp2 A T 14: 103,169,994 I2740K probably benign Het
Naif1 T A 2: 32,454,836 V184E probably damaging Het
Neurl1b T C 17: 26,441,773 V540A probably damaging Het
Nt5c1b T A 12: 10,381,450 F451Y probably damaging Het
Obox3 A G 7: 15,626,223 S174P probably benign Het
Obscn T C 11: 59,061,068 E3953G probably damaging Het
Olfr1180 A T 2: 88,412,251 C136S probably damaging Het
Olfr1247 A C 2: 89,609,947 S52A probably benign Het
Pkd1l1 G A 11: 8,865,550 H1904Y Het
Plec C T 15: 76,175,331 D3469N probably benign Het
Ppp1r16b G A 2: 158,761,366 E404K possibly damaging Het
Prkce T A 17: 86,488,197 N287K probably damaging Het
Rchy1 C A 5: 91,957,538 C108F probably damaging Het
Sema6d A G 2: 124,660,312 Y572C possibly damaging Het
Sh3rf1 T A 8: 61,329,996 I248K probably damaging Het
Sin3b T C 8: 72,723,398 L30P probably damaging Het
Slc25a47 G A 12: 108,854,387 G106S probably damaging Het
Slc43a2 A C 11: 75,567,053 M385L probably benign Het
Slc43a3 A G 2: 84,938,327 T97A probably damaging Het
Slc9b2 T A 3: 135,324,590 S223T probably benign Het
Smc5 A T 19: 23,265,694 C118S probably damaging Het
Smpdl3b T C 4: 132,745,180 D94G probably damaging Het
Spred3 A G 7: 29,166,661 V71A possibly damaging Het
Srsf5 T A 12: 80,947,554 S86T possibly damaging Het
Sycp2 A G 2: 178,348,295 V1386A probably benign Het
Syne2 T C 12: 76,057,484 L743P probably damaging Het
Synj1 A G 16: 91,010,083 V62A probably damaging Het
Tbc1d9b T C 11: 50,156,751 L637P probably damaging Het
Tcf12 T G 9: 71,849,815 S697R possibly damaging Het
Tnfrsf11b T A 15: 54,260,112 Y31F possibly damaging Het
Trav5n-4 T C 14: 53,312,905 M1T probably null Het
Trbv13-2 A G 6: 41,121,782 E97G probably benign Het
Trpa1 G A 1: 14,910,774 P135S probably damaging Het
Ugt1a6a A C 1: 88,138,868 D132A possibly damaging Het
Vmn2r8 A T 5: 108,798,096 D548E possibly damaging Het
Zbtb39 A T 10: 127,742,946 D463V probably damaging Het
Zfp952 C T 17: 33,003,030 P161L possibly damaging Het
Other mutations in Polr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Polr1b APN 2 129125909 missense probably damaging 1.00
IGL00559:Polr1b APN 2 129113731 missense probably damaging 1.00
IGL00659:Polr1b APN 2 129118100 critical splice donor site probably null
IGL00672:Polr1b APN 2 129125472 missense probably damaging 1.00
IGL01066:Polr1b APN 2 129119152 missense probably damaging 1.00
IGL01536:Polr1b APN 2 129125555 missense probably benign 0.00
IGL01596:Polr1b APN 2 129110126 missense probably benign 0.38
IGL02156:Polr1b APN 2 129123879 missense probably benign 0.40
IGL02398:Polr1b APN 2 129102966 missense probably benign 0.03
IGL02797:Polr1b APN 2 129102979 missense probably damaging 0.99
IGL02965:Polr1b APN 2 129125523 missense probably benign 0.41
IGL03009:Polr1b APN 2 129126068 missense probably damaging 1.00
IGL03092:Polr1b APN 2 129123129 missense probably damaging 1.00
IGL03129:Polr1b APN 2 129115707 missense probably benign 0.00
IGL03138:Polr1b UTSW 2 129102988 missense probably benign 0.04
PIT4362001:Polr1b UTSW 2 129109292 missense possibly damaging 0.84
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0989:Polr1b UTSW 2 129126077 missense probably damaging 0.97
R1508:Polr1b UTSW 2 129113734 missense probably benign 0.24
R1539:Polr1b UTSW 2 129118099 critical splice donor site probably null
R1700:Polr1b UTSW 2 129123121 missense probably damaging 0.99
R1843:Polr1b UTSW 2 129102966 missense probably benign 0.03
R1920:Polr1b UTSW 2 129101111 missense probably benign 0.00
R2414:Polr1b UTSW 2 129103134 splice site probably benign
R3020:Polr1b UTSW 2 129115681 missense probably benign 0.01
R3837:Polr1b UTSW 2 129119107 missense possibly damaging 0.78
R4466:Polr1b UTSW 2 129123882 missense probably benign 0.03
R4773:Polr1b UTSW 2 129105328 missense probably benign 0.29
R4789:Polr1b UTSW 2 129109337 missense probably benign 0.00
R5027:Polr1b UTSW 2 129123883 missense possibly damaging 0.94
R5579:Polr1b UTSW 2 129110108 missense probably damaging 1.00
R5705:Polr1b UTSW 2 129105351 nonsense probably null
R6303:Polr1b UTSW 2 129115762 missense probably damaging 1.00
R6313:Polr1b UTSW 2 129125446 missense probably damaging 1.00
R6427:Polr1b UTSW 2 129123261 missense probably damaging 0.99
R6677:Polr1b UTSW 2 129120211 intron probably benign
R7033:Polr1b UTSW 2 129115642 missense possibly damaging 0.82
R7163:Polr1b UTSW 2 129126011 missense probably benign 0.44
R7184:Polr1b UTSW 2 129123922 missense possibly damaging 0.94
R7376:Polr1b UTSW 2 129119073 missense probably benign 0.00
R7453:Polr1b UTSW 2 129125663 missense probably damaging 1.00
R7545:Polr1b UTSW 2 129117846 splice site probably null
R7770:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7772:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7774:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7776:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7777:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7814:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7825:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7826:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7827:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7828:Polr1b UTSW 2 129105280 missense probably damaging 1.00
R7959:Polr1b UTSW 2 129108094 missense probably damaging 1.00
R8082:Polr1b UTSW 2 129115732 missense probably benign 0.18
R8251:Polr1b UTSW 2 129123166 missense probably damaging 1.00
R8696:Polr1b UTSW 2 129125651 missense probably damaging 1.00
R8746:Polr1b UTSW 2 129112677 missense possibly damaging 0.70
R8823:Polr1b UTSW 2 129125537 missense probably damaging 1.00
R8872:Polr1b UTSW 2 129115693 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTTCCCAGAAGGCCACG -3'
(R):5'- ATACTGTAGGCACCCCTCAC -3'

Sequencing Primer
(F):5'- CCAGAAGGCCACGGGGTAG -3'
(R):5'- GGCCACTTCTCCCAACCG -3'
Posted On2021-04-30