Incidental Mutation 'R8711:Fhad1'
ID669562
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R8711 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141957613 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 472 (N472Y)
Ref Sequence ENSEMBL: ENSMUSP00000101405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably benign
Transcript: ENSMUST00000105779
AA Change: N472Y

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: N472Y

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105780
AA Change: N472Y

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: N472Y

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,516,086 S122T probably benign Het
Abcb11 G A 2: 69,265,512 T828I probably damaging Het
Atp5b T A 10: 128,085,500 N222K probably damaging Het
C1qbp T C 11: 70,978,487 T211A probably benign Het
Ccdc85a A T 11: 28,434,146 S410T possibly damaging Het
Col10a1 G T 10: 34,394,828 K265N probably damaging Het
Cyp2j5 A T 4: 96,641,423 M237K possibly damaging Het
Cyp4f40 T C 17: 32,675,988 probably benign Het
Cytip A T 2: 58,151,123 F90L probably damaging Het
Dnah7b A G 1: 46,175,438 D1121G probably damaging Het
Dohh G T 10: 81,386,025 E84D probably benign Het
Eif4g2 T C 7: 111,073,920 Y855C probably damaging Het
Ell T A 8: 70,581,681 probably benign Het
Ermap T C 4: 119,187,158 Y147C probably damaging Het
Fasn T C 11: 120,819,118 D371G possibly damaging Het
Fat2 A G 11: 55,268,303 S3348P probably benign Het
Flad1 A G 3: 89,409,108 V49A probably damaging Het
Fpr-rs3 T C 17: 20,624,292 T196A probably benign Het
Fsip2 A G 2: 82,984,902 N3660D possibly damaging Het
Gabrp T A 11: 33,555,023 L259F probably damaging Het
Gm11639 A G 11: 104,852,545 I2187V probably benign Het
Gm16686 A T 4: 88,755,236 W119R unknown Het
Gm17660 G A 5: 104,072,090 T78I unknown Het
Gm21319 T A 12: 87,773,360 D143V unknown Het
Gng2 C T 14: 19,891,370 M1I probably null Het
Hmgxb3 T C 18: 61,157,649 N384S probably benign Het
Ibtk T C 9: 85,724,155 I440V probably benign Het
Il11ra1 A G 4: 41,767,539 D297G probably damaging Het
Irf2bpl T C 12: 86,881,722 I726V probably benign Het
Klk1b5 A G 7: 44,218,572 N56S probably benign Het
Laptm4b T A 15: 34,277,502 V193E probably damaging Het
Lrrc37a A T 11: 103,497,524 C2358* probably null Het
Ltbp2 C T 12: 84,853,741 S269N probably benign Het
Morc2a T G 11: 3,680,013 Y450D probably damaging Het
Mycbp2 A T 14: 103,169,994 I2740K probably benign Het
Naif1 T A 2: 32,454,836 V184E probably damaging Het
Neurl1b T C 17: 26,441,773 V540A probably damaging Het
Nt5c1b T A 12: 10,381,450 F451Y probably damaging Het
Obox3 A G 7: 15,626,223 S174P probably benign Het
Obscn T C 11: 59,061,068 E3953G probably damaging Het
Olfr1180 A T 2: 88,412,251 C136S probably damaging Het
Olfr1247 A C 2: 89,609,947 S52A probably benign Het
Pkd1l1 G A 11: 8,865,550 H1904Y Het
Plec C T 15: 76,175,331 D3469N probably benign Het
Polr1b A G 2: 129,101,144 T20A probably damaging Het
Ppp1r16b G A 2: 158,761,366 E404K possibly damaging Het
Prkce T A 17: 86,488,197 N287K probably damaging Het
Rchy1 C A 5: 91,957,538 C108F probably damaging Het
Sema6d A G 2: 124,660,312 Y572C possibly damaging Het
Sh3rf1 T A 8: 61,329,996 I248K probably damaging Het
Sin3b T C 8: 72,723,398 L30P probably damaging Het
Slc25a47 G A 12: 108,854,387 G106S probably damaging Het
Slc43a2 A C 11: 75,567,053 M385L probably benign Het
Slc43a3 A G 2: 84,938,327 T97A probably damaging Het
Slc9b2 T A 3: 135,324,590 S223T probably benign Het
Smc5 A T 19: 23,265,694 C118S probably damaging Het
Smpdl3b T C 4: 132,745,180 D94G probably damaging Het
Spred3 A G 7: 29,166,661 V71A possibly damaging Het
Srsf5 T A 12: 80,947,554 S86T possibly damaging Het
Sycp2 A G 2: 178,348,295 V1386A probably benign Het
Syne2 T C 12: 76,057,484 L743P probably damaging Het
Synj1 A G 16: 91,010,083 V62A probably damaging Het
Tbc1d9b T C 11: 50,156,751 L637P probably damaging Het
Tcf12 T G 9: 71,849,815 S697R possibly damaging Het
Tnfrsf11b T A 15: 54,260,112 Y31F possibly damaging Het
Trav5n-4 T C 14: 53,312,905 M1T probably null Het
Trbv13-2 A G 6: 41,121,782 E97G probably benign Het
Trpa1 G A 1: 14,910,774 P135S probably damaging Het
Ugt1a6a A C 1: 88,138,868 D132A possibly damaging Het
Vmn2r8 A T 5: 108,798,096 D548E possibly damaging Het
Zbtb39 A T 10: 127,742,946 D463V probably damaging Het
Zfp952 C T 17: 33,003,030 P161L possibly damaging Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
R4466_Fhad1_343 UTSW 4 141957658 missense probably damaging 1.00
R4831_Fhad1_494 UTSW 4 141916067 splice site probably null
R5504_Fhad1_818 UTSW 4 141985535 missense probably benign
BB002:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
BB012:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
R7472:Fhad1 UTSW 4 141964626 missense probably benign
R7670:Fhad1 UTSW 4 141951491 missense probably benign 0.01
R7694:Fhad1 UTSW 4 141905064 missense probably benign 0.41
R7745:Fhad1 UTSW 4 141890939 missense probably benign 0.00
R7848:Fhad1 UTSW 4 141905602 missense probably benign 0.29
R7853:Fhad1 UTSW 4 141909823 missense probably damaging 0.99
R7867:Fhad1 UTSW 4 141905591 missense probably benign 0.00
R7925:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
R8089:Fhad1 UTSW 4 141957660 missense probably damaging 1.00
R8123:Fhad1 UTSW 4 141985525 missense probably benign 0.02
R8751:Fhad1 UTSW 4 141918823 missense probably benign 0.04
R8783:Fhad1 UTSW 4 141909092 missense probably benign 0.02
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGACATCCCAGCTGTTGATG -3'
(R):5'- TAAGCCAGCTTCCTCACCAG -3'

Sequencing Primer
(F):5'- CAGCTGTTGATGGGTGGAAC -3'
(R):5'- AGCTTCCTCACCAGACTCACTTTTG -3'
Posted On2021-04-30