Mutagenetix > Incidental Mutations

Incidental Mutation 'R0518:Glb1'

66958

Institutional Source

Beutler Lab

Gene Symbol

Glb1

Ensembl Gene

ENSMUSG00000045594

Gene Name

galactosidase, beta 1

Synonyms

C130097A14Rik, Bgs, Bgl-t, Bgl, Bgl-e, Bgt, Bge, Bgl-s

MMRRC Submission

038711-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0518 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

114401076-114474898 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

ACCC to ACC at 114421744 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000149937 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063042] [ENSMUST00000217583]

Predicted Effect

probably null
Transcript: ENSMUST00000063042

SMART Domains

Protein: ENSMUSP00000055803
Gene: ENSMUSG00000045594

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Glyco_hydro_35	41	358	2.5e-129	PFAM
Pfam:Glyco_hydro_42	56	216	9.4e-15	PFAM
Pfam:BetaGal_dom4_5	531	623	4.3e-10	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000217583

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is a lysosomal enzyme that catalyzes the hydrolysis of terminal beta-D-galactose residues in various substrates like lactose, ganglioside GM1 and other glycoproteins. Mutations in the human gene are associated with GM1-gangliosidosis and Morquio B syndrome. Disruption of the mouse gene mirrors the symptoms of human gangliosidosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit progressive spastic diplegia, emaciation, and accumulation of ganglioside GM1 and asialo GM1 in brain tissue. Mutants die at 7-10 months of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
2900011O08Rik	T	A	16: 13,986,812	S8T	possibly damaging	Het
Acaca	A	G	11: 84,290,286		probably null	Het
Acsm5	T	C	7: 119,535,800	V327A	possibly damaging	Het
Agt	C	A	8: 124,557,100	E427*	probably null	Het
Akr1c14	T	C	13: 4,081,016	L236S	probably damaging	Het
Ammecr1l	C	T	18: 31,771,901	S65L	probably benign	Het
Ankrd33b	T	C	15: 31,367,286	D36G	probably damaging	Het
Ano8	A	T	8: 71,479,258	C766S	probably benign	Het
Arhgef16	G	T	4: 154,291,034	P168T	probably damaging	Het
Asic1	C	T	15: 99,698,819	R499C	probably damaging	Het
Bank1	C	T	3: 136,213,942	C364Y	probably damaging	Het
Cacna1s	C	A	1: 136,076,859	D132E	probably benign	Het
Capn5	C	T	7: 98,132,882	R217Q	probably damaging	Het
Clasrp	A	G	7: 19,588,603	I284T	probably benign	Het
Coa3	T	A	11: 101,278,890	K13M	probably damaging	Het
Col13a1	A	T	10: 61,862,746	M512K	unknown	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Crhbp	C	A	13: 95,443,895		probably null	Het
Cryba2	T	C	1: 74,890,125	Y153C	possibly damaging	Het
Cryzl2	T	C	1: 157,464,430	V93A	probably damaging	Het
Ctsl	G	A	13: 64,365,218	L297F	possibly damaging	Het
Cyp2r1	T	G	7: 114,552,900	H274P	probably benign	Het
Ddx4	A	T	13: 112,624,779		probably null	Het
Ddx58	C	T	4: 40,216,354		probably null	Het
Dnd1	A	G	18: 36,764,043	V350A	possibly damaging	Het
Dsg1b	A	T	18: 20,388,164	Q26L	probably benign	Het
Fam173b	T	G	15: 31,605,957	S20R	probably benign	Het
Fam20b	C	A	1: 156,687,456	V280F	possibly damaging	Het
Foxb2	G	T	19: 16,872,456	C395*	probably null	Het
Gm9930	A	T	10: 9,534,803		noncoding transcript	Het
Hdac7	G	A	15: 97,806,499	Q497*	probably null	Het
Hk3	C	T	13: 55,014,426		probably null	Het
Hsd3b7	A	G	7: 127,803,079	T330A	probably benign	Het
Il20ra	A	T	10: 19,759,640	Q543L	probably damaging	Het
Itk	T	A	11: 46,360,288	D163V	probably damaging	Het
Kcnu1	T	G	8: 25,910,888	L688R	probably damaging	Het
Kng1	G	A	16: 23,060,482	A45T	possibly damaging	Het
Kti12	T	A	4: 108,848,579	V230E	possibly damaging	Het
Mgat5	T	A	1: 127,384,847	I241N	probably damaging	Het
Mkln1	A	G	6: 31,468,132	N321S	probably benign	Het
Mllt10	T	G	2: 18,071,206		probably null	Het
Ms4a1	C	A	19: 11,258,679		probably null	Het
Ngly1	C	T	14: 16,290,774	Q419*	probably null	Het
Nipsnap3b	T	A	4: 53,021,343	F243I	probably damaging	Het
Ogfod1	T	A	8: 94,055,248		probably null	Het
Olfr1381	C	T	11: 49,552,464	T239M	probably damaging	Het
Olfr624	T	A	7: 103,670,489	I181F	possibly damaging	Het
Olfr714	T	A	7: 107,074,758	L310Q	possibly damaging	Het
Olfr898	A	C	9: 38,349,203	N40T	probably damaging	Het
P2ry14	T	A	3: 59,115,204	E287D	probably damaging	Het
Pank4	A	T	4: 154,976,625	R510S	possibly damaging	Het
Pcsk6	T	A	7: 65,980,167	V347E	possibly damaging	Het
Peg3	T	C	7: 6,711,428	E265G	probably damaging	Het
Pik3c2b	C	A	1: 133,105,992	P1578H	probably damaging	Het
Pkd1	A	G	17: 24,595,219	S4188G	probably benign	Het
Ppp1r26	A	G	2: 28,452,302	D648G	probably damaging	Het
Ptprs	A	G	17: 56,419,621		probably null	Het
Rab24	A	T	13: 55,320,925		probably null	Het
Rap1gap2	A	T	11: 74,441,766	M71K	probably damaging	Het
Rergl	T	G	6: 139,496,526	K42T	probably damaging	Het
Sept5	T	C	16: 18,624,897	T92A	probably benign	Het
Ski	A	G	4: 155,159,286		probably null	Het
Slc17a8	A	G	10: 89,576,330	S414P	probably benign	Het
Slc25a36	A	T	9: 97,097,175	I71N	probably damaging	Het
Syne2	A	C	12: 76,108,862		probably null	Het
Tdrd5	C	A	1: 156,262,941	W845L	probably damaging	Het
Tfb2m	T	C	1: 179,537,824	I192V	possibly damaging	Het
Tll1	T	G	8: 64,098,471	D292A	probably damaging	Het
Tmem211	T	A	5: 113,236,007	L97*	probably null	Het
Trank1	A	C	9: 111,333,808	D45A	probably damaging	Het
Trim17	T	A	11: 58,968,494	V178E	probably damaging	Het
Trim9	A	T	12: 70,346,585	L195Q	probably damaging	Het
Ttc27	A	T	17: 74,856,549	R717S	possibly damaging	Het
Upk2	G	T	9: 44,454,121	P50Q	probably damaging	Het
Usp9y	A	T	Y: 1,307,880	C2319S	probably benign	Het
Vmn1r4	G	T	6: 56,956,898	C129F	probably benign	Het
Vmn2r100	A	T	17: 19,521,916	D184V	probably damaging	Het
Wdr78	A	C	4: 103,064,530	Y464*	probably null	Het
Xpnpep3	T	G	15: 81,427,492	I133S	possibly damaging	Het
Zfp628	A	T	7: 4,919,940	Q387L	probably damaging	Het
Zic2	CCCACCACCACCATCACCACCACCACC	CCCACCATCACCACCACCACC	14: 122,476,364		probably benign	Het

Other mutations in Glb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01448:Glb1	APN	9	114450677	splice site	probably benign
IGL01649:Glb1	APN	9	114423948	missense	probably damaging	1.00
IGL01720:Glb1	APN	9	114420505	critical splice donor site	probably null
IGL02199:Glb1	APN	9	114473947	missense	probably benign	0.06
IGL02613:Glb1	APN	9	114464062	missense	possibly damaging	0.91
IGL03392:Glb1	APN	9	114430321	missense	probably damaging	1.00
R0463:Glb1	UTSW	9	114421744	frame shift	probably null
R0519:Glb1	UTSW	9	114421744	frame shift	probably null
R0520:Glb1	UTSW	9	114421744	frame shift	probably null
R1387:Glb1	UTSW	9	114420363	missense	probably damaging	1.00
R1499:Glb1	UTSW	9	114417103	missense	probably benign	0.04
R1898:Glb1	UTSW	9	114424035	missense	probably damaging	1.00
R2143:Glb1	UTSW	9	114437824	missense	probably damaging	1.00
R2145:Glb1	UTSW	9	114464165	missense	probably benign	0.00
R2146:Glb1	UTSW	9	114450648	missense	probably damaging	1.00
R2148:Glb1	UTSW	9	114450648	missense	probably damaging	1.00
R2149:Glb1	UTSW	9	114450648	missense	probably damaging	1.00
R2150:Glb1	UTSW	9	114450648	missense	probably damaging	1.00
R2170:Glb1	UTSW	9	114473805	critical splice acceptor site	probably benign
R2259:Glb1	UTSW	9	114443032	nonsense	probably null
R2401:Glb1	UTSW	9	114454257	missense	possibly damaging	0.81
R3980:Glb1	UTSW	9	114417064	missense	probably damaging	0.97
R4488:Glb1	UTSW	9	114443114	missense	probably damaging	1.00
R4696:Glb1	UTSW	9	114464152	missense	probably benign
R5349:Glb1	UTSW	9	114434461	critical splice donor site	probably null
R6045:Glb1	UTSW	9	114437942	missense	probably damaging	1.00
R6448:Glb1	UTSW	9	114434431	missense	probably damaging	0.99
R7308:Glb1	UTSW	9	114473863	missense	probably damaging	0.98
R7327:Glb1	UTSW	9	114417058	missense	probably benign	0.00
R7492:Glb1	UTSW	9	114473949	missense	probably damaging	1.00
R8087:Glb1	UTSW	9	114430415	missense	probably damaging	1.00
R8181:Glb1	UTSW	9	114430361	missense	probably damaging	1.00
X0052:Glb1	UTSW	9	114473805	critical splice acceptor site	probably benign
Z1177:Glb1	UTSW	9	114420422	missense	probably damaging	0.98

Predicted Primers

Posted On

2013-08-19