Incidental Mutation 'R8711:Pkd1l1'
ID669582
Institutional Source Beutler Lab
Gene Symbol Pkd1l1
Ensembl Gene ENSMUSG00000046634
Gene Namepolycystic kidney disease 1 like 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8711 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location8826708-8973266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8865550 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 1904 (H1904Y)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178195]
Predicted Effect
SMART Domains Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: H1904Y

DomainStartEndE-ValueType
low complexity region 172 184 N/A INTRINSIC
PKD 205 287 2.9e0 SMART
PKD 291 369 1.42e-9 SMART
Pfam:REJ 398 1001 1.7e-45 PFAM
low complexity region 1208 1218 N/A INTRINSIC
GPS 1370 1413 1.21e-1 SMART
transmembrane domain 1434 1451 N/A INTRINSIC
LH2 1479 1598 2.94e-3 SMART
transmembrane domain 1640 1659 N/A INTRINSIC
transmembrane domain 1679 1701 N/A INTRINSIC
transmembrane domain 1817 1839 N/A INTRINSIC
transmembrane domain 1854 1876 N/A INTRINSIC
Pfam:PKD_channel 2109 2339 1.5e-23 PFAM
transmembrane domain 2381 2403 N/A INTRINSIC
low complexity region 2436 2449 N/A INTRINSIC
low complexity region 2458 2469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178195
AA Change: H1454Y

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: H1454Y

DomainStartEndE-ValueType
Pfam:REJ 3 552 3.3e-41 PFAM
low complexity region 757 767 N/A INTRINSIC
Blast:GPS 919 965 2e-13 BLAST
transmembrane domain 983 1000 N/A INTRINSIC
Pfam:PLAT 1030 1145 7.2e-14 PFAM
transmembrane domain 1189 1208 N/A INTRINSIC
transmembrane domain 1228 1250 N/A INTRINSIC
transmembrane domain 1366 1388 N/A INTRINSIC
transmembrane domain 1403 1425 N/A INTRINSIC
Pfam:PKD_channel 1658 1889 2e-25 PFAM
transmembrane domain 1930 1952 N/A INTRINSIC
low complexity region 1985 1998 N/A INTRINSIC
low complexity region 2007 2018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,516,086 S122T probably benign Het
Abcb11 G A 2: 69,265,512 T828I probably damaging Het
Atp5b T A 10: 128,085,500 N222K probably damaging Het
C1qbp T C 11: 70,978,487 T211A probably benign Het
Ccdc85a A T 11: 28,434,146 S410T possibly damaging Het
Col10a1 G T 10: 34,394,828 K265N probably damaging Het
Cyp2j5 A T 4: 96,641,423 M237K possibly damaging Het
Cyp4f40 T C 17: 32,675,988 probably benign Het
Cytip A T 2: 58,151,123 F90L probably damaging Het
Dnah7b A G 1: 46,175,438 D1121G probably damaging Het
Dohh G T 10: 81,386,025 E84D probably benign Het
Eif4g2 T C 7: 111,073,920 Y855C probably damaging Het
Ell T A 8: 70,581,681 probably benign Het
Ermap T C 4: 119,187,158 Y147C probably damaging Het
Fasn T C 11: 120,819,118 D371G possibly damaging Het
Fat2 A G 11: 55,268,303 S3348P probably benign Het
Fhad1 T A 4: 141,957,613 N472Y probably benign Het
Flad1 A G 3: 89,409,108 V49A probably damaging Het
Fpr-rs3 T C 17: 20,624,292 T196A probably benign Het
Fsip2 A G 2: 82,984,902 N3660D possibly damaging Het
Gabrp T A 11: 33,555,023 L259F probably damaging Het
Gm11639 A G 11: 104,852,545 I2187V probably benign Het
Gm16686 A T 4: 88,755,236 W119R unknown Het
Gm17660 G A 5: 104,072,090 T78I unknown Het
Gm21319 T A 12: 87,773,360 D143V unknown Het
Gng2 C T 14: 19,891,370 M1I probably null Het
Hmgxb3 T C 18: 61,157,649 N384S probably benign Het
Ibtk T C 9: 85,724,155 I440V probably benign Het
Il11ra1 A G 4: 41,767,539 D297G probably damaging Het
Irf2bpl T C 12: 86,881,722 I726V probably benign Het
Klk1b5 A G 7: 44,218,572 N56S probably benign Het
Laptm4b T A 15: 34,277,502 V193E probably damaging Het
Lrrc37a A T 11: 103,497,524 C2358* probably null Het
Ltbp2 C T 12: 84,853,741 S269N probably benign Het
Morc2a T G 11: 3,680,013 Y450D probably damaging Het
Mycbp2 A T 14: 103,169,994 I2740K probably benign Het
Naif1 T A 2: 32,454,836 V184E probably damaging Het
Neurl1b T C 17: 26,441,773 V540A probably damaging Het
Nt5c1b T A 12: 10,381,450 F451Y probably damaging Het
Obox3 A G 7: 15,626,223 S174P probably benign Het
Obscn T C 11: 59,061,068 E3953G probably damaging Het
Olfr1180 A T 2: 88,412,251 C136S probably damaging Het
Olfr1247 A C 2: 89,609,947 S52A probably benign Het
Plec C T 15: 76,175,331 D3469N probably benign Het
Polr1b A G 2: 129,101,144 T20A probably damaging Het
Ppp1r16b G A 2: 158,761,366 E404K possibly damaging Het
Prkce T A 17: 86,488,197 N287K probably damaging Het
Rchy1 C A 5: 91,957,538 C108F probably damaging Het
Sema6d A G 2: 124,660,312 Y572C possibly damaging Het
Sh3rf1 T A 8: 61,329,996 I248K probably damaging Het
Sin3b T C 8: 72,723,398 L30P probably damaging Het
Slc25a47 G A 12: 108,854,387 G106S probably damaging Het
Slc43a2 A C 11: 75,567,053 M385L probably benign Het
Slc43a3 A G 2: 84,938,327 T97A probably damaging Het
Slc9b2 T A 3: 135,324,590 S223T probably benign Het
Smc5 A T 19: 23,265,694 C118S probably damaging Het
Smpdl3b T C 4: 132,745,180 D94G probably damaging Het
Spred3 A G 7: 29,166,661 V71A possibly damaging Het
Srsf5 T A 12: 80,947,554 S86T possibly damaging Het
Sycp2 A G 2: 178,348,295 V1386A probably benign Het
Syne2 T C 12: 76,057,484 L743P probably damaging Het
Synj1 A G 16: 91,010,083 V62A probably damaging Het
Tbc1d9b T C 11: 50,156,751 L637P probably damaging Het
Tcf12 T G 9: 71,849,815 S697R possibly damaging Het
Tnfrsf11b T A 15: 54,260,112 Y31F possibly damaging Het
Trav5n-4 T C 14: 53,312,905 M1T probably null Het
Trbv13-2 A G 6: 41,121,782 E97G probably benign Het
Trpa1 G A 1: 14,910,774 P135S probably damaging Het
Ugt1a6a A C 1: 88,138,868 D132A possibly damaging Het
Vmn2r8 A T 5: 108,798,096 D548E possibly damaging Het
Zbtb39 A T 10: 127,742,946 D463V probably damaging Het
Zfp952 C T 17: 33,003,030 P161L possibly damaging Het
Other mutations in Pkd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pkd1l1 APN 11 8961971 missense unknown
IGL00156:Pkd1l1 APN 11 8950515 missense probably damaging 1.00
IGL00161:Pkd1l1 APN 11 8929353 critical splice donor site probably null
IGL00489:Pkd1l1 APN 11 8834773 critical splice donor site probably null
IGL00495:Pkd1l1 APN 11 8868493 missense probably benign 0.34
IGL00983:Pkd1l1 APN 11 8844585 missense probably benign
IGL01071:Pkd1l1 APN 11 8848921 missense probably benign 0.00
IGL01093:Pkd1l1 APN 11 8901345 missense probably benign 0.06
IGL01295:Pkd1l1 APN 11 8933685 missense possibly damaging 0.93
IGL01311:Pkd1l1 APN 11 8901174 missense possibly damaging 0.53
IGL01412:Pkd1l1 APN 11 8950409 missense possibly damaging 0.73
IGL01978:Pkd1l1 APN 11 8961336 missense unknown
IGL01999:Pkd1l1 APN 11 8836291 missense probably benign
IGL02080:Pkd1l1 APN 11 8961345 missense unknown
IGL02106:Pkd1l1 APN 11 8833800 missense probably damaging 1.00
IGL02216:Pkd1l1 APN 11 8834897 missense probably damaging 0.96
IGL02305:Pkd1l1 APN 11 8902467 missense probably benign
IGL02337:Pkd1l1 APN 11 8942079 missense probably damaging 1.00
IGL02576:Pkd1l1 APN 11 8844560 missense possibly damaging 0.61
IGL02704:Pkd1l1 APN 11 8834910 missense probably benign 0.00
IGL02814:Pkd1l1 APN 11 8902582 missense probably benign 0.01
IGL02904:Pkd1l1 APN 11 8868450 splice site probably benign
IGL02972:Pkd1l1 APN 11 8863908 missense probably damaging 0.99
IGL03091:Pkd1l1 APN 11 8855564 missense probably damaging 1.00
IGL03113:Pkd1l1 APN 11 8834793 missense probably benign 0.20
IGL03210:Pkd1l1 APN 11 8965127 missense unknown
PIT4581001:Pkd1l1 UTSW 11 8916298 frame shift probably null
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0496:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
R0547:Pkd1l1 UTSW 11 8836448 splice site probably benign
R0582:Pkd1l1 UTSW 11 8931699 splice site probably benign
R0761:Pkd1l1 UTSW 11 8854375 missense probably damaging 1.00
R0969:Pkd1l1 UTSW 11 8936898 missense probably damaging 1.00
R1348:Pkd1l1 UTSW 11 8834806 missense probably benign 0.18
R1366:Pkd1l1 UTSW 11 8941038 splice site probably benign
R1401:Pkd1l1 UTSW 11 8854487 nonsense probably null
R1444:Pkd1l1 UTSW 11 8854386 missense probably damaging 1.00
R1445:Pkd1l1 UTSW 11 8870313 missense probably benign 0.00
R1463:Pkd1l1 UTSW 11 8916302 missense probably damaging 1.00
R1496:Pkd1l1 UTSW 11 8941077 missense possibly damaging 0.95
R1542:Pkd1l1 UTSW 11 8874179 missense possibly damaging 0.82
R1543:Pkd1l1 UTSW 11 8901200 missense probably damaging 1.00
R1619:Pkd1l1 UTSW 11 8950413 missense probably damaging 0.98
R1875:Pkd1l1 UTSW 11 8844670 splice site probably benign
R1929:Pkd1l1 UTSW 11 8836197 splice site probably benign
R1958:Pkd1l1 UTSW 11 8874161 missense probably benign 0.01
R2223:Pkd1l1 UTSW 11 8889063 missense probably benign 0.18
R2223:Pkd1l1 UTSW 11 8950422 missense probably benign
R2264:Pkd1l1 UTSW 11 8879112 missense probably damaging 0.97
R2349:Pkd1l1 UTSW 11 8826819 splice site probably null
R2431:Pkd1l1 UTSW 11 8947197 missense probably damaging 0.99
R2483:Pkd1l1 UTSW 11 8962701 missense probably damaging 1.00
R2517:Pkd1l1 UTSW 11 8958900 missense unknown
R2888:Pkd1l1 UTSW 11 8947251 missense probably damaging 1.00
R2965:Pkd1l1 UTSW 11 8874236 missense probably damaging 1.00
R3123:Pkd1l1 UTSW 11 8973021 missense unknown
R3153:Pkd1l1 UTSW 11 8867207 missense probably benign 0.01
R3840:Pkd1l1 UTSW 11 8889050 missense probably damaging 1.00
R3855:Pkd1l1 UTSW 11 8965047 critical splice donor site probably null
R3880:Pkd1l1 UTSW 11 8961983 missense unknown
R3970:Pkd1l1 UTSW 11 8874218 missense probably damaging 1.00
R4195:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4196:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4246:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4247:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4249:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4250:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4593:Pkd1l1 UTSW 11 8901253 missense probably damaging 0.97
R4609:Pkd1l1 UTSW 11 8958964 missense unknown
R4797:Pkd1l1 UTSW 11 8961340 missense unknown
R4910:Pkd1l1 UTSW 11 8929360 missense possibly damaging 0.50
R4940:Pkd1l1 UTSW 11 8844585 missense probably benign
R5084:Pkd1l1 UTSW 11 8942004 missense probably benign 0.05
R5147:Pkd1l1 UTSW 11 8849003 missense possibly damaging 0.71
R5360:Pkd1l1 UTSW 11 8879204 missense probably benign
R5483:Pkd1l1 UTSW 11 8901141 critical splice donor site probably null
R5604:Pkd1l1 UTSW 11 8833877 missense probably damaging 0.98
R5642:Pkd1l1 UTSW 11 8879202 missense probably damaging 1.00
R5652:Pkd1l1 UTSW 11 8909889 missense probably benign 0.03
R5751:Pkd1l1 UTSW 11 8867204 missense possibly damaging 0.45
R5761:Pkd1l1 UTSW 11 8916301 missense probably damaging 1.00
R5800:Pkd1l1 UTSW 11 8861302 missense probably benign
R5874:Pkd1l1 UTSW 11 8908688 missense probably damaging 1.00
R5897:Pkd1l1 UTSW 11 8879176 missense probably benign 0.03
R5913:Pkd1l1 UTSW 11 8863849 missense probably benign 0.00
R5930:Pkd1l1 UTSW 11 8958969 missense unknown
R6000:Pkd1l1 UTSW 11 8950427 missense probably benign 0.00
R6005:Pkd1l1 UTSW 11 8857113 missense probably damaging 1.00
R6013:Pkd1l1 UTSW 11 8869452 splice site probably null
R6027:Pkd1l1 UTSW 11 8916272 nonsense probably null
R6028:Pkd1l1 UTSW 11 8836267 missense probably benign 0.06
R6129:Pkd1l1 UTSW 11 8868543 missense probably benign 0.00
R6182:Pkd1l1 UTSW 11 8865555 missense probably benign 0.36
R6226:Pkd1l1 UTSW 11 8901287 missense probably benign 0.00
R6257:Pkd1l1 UTSW 11 8942195 missense probably benign 0.22
R6340:Pkd1l1 UTSW 11 8844649 missense probably benign 0.09
R6478:Pkd1l1 UTSW 11 8863911 missense probably benign 0.00
R6558:Pkd1l1 UTSW 11 8889052 missense probably benign 0.00
R6750:Pkd1l1 UTSW 11 8973217 missense unknown
R6987:Pkd1l1 UTSW 11 8902575 missense probably benign 0.01
R6996:Pkd1l1 UTSW 11 8849046 missense probably damaging 1.00
R7139:Pkd1l1 UTSW 11 8890737 missense
R7224:Pkd1l1 UTSW 11 8945241 missense
R7244:Pkd1l1 UTSW 11 8871771 missense
R7265:Pkd1l1 UTSW 11 8929402 missense
R7358:Pkd1l1 UTSW 11 8945202 missense
R7387:Pkd1l1 UTSW 11 8901203 missense
R7414:Pkd1l1 UTSW 11 8916267 missense
R7459:Pkd1l1 UTSW 11 8902428 missense
R7478:Pkd1l1 UTSW 11 8929441 missense
R7485:Pkd1l1 UTSW 11 8965148 missense
R7490:Pkd1l1 UTSW 11 8916265 missense
R7644:Pkd1l1 UTSW 11 8875758 missense
R7647:Pkd1l1 UTSW 11 8947296 missense
R7676:Pkd1l1 UTSW 11 8962708 missense
R7687:Pkd1l1 UTSW 11 8854390 missense
R7699:Pkd1l1 UTSW 11 8965142 missense
R7922:Pkd1l1 UTSW 11 8849013 missense
R7922:Pkd1l1 UTSW 11 8909857 missense
R7980:Pkd1l1 UTSW 11 8854375 missense probably damaging 1.00
R7993:Pkd1l1 UTSW 11 8945262 missense
R8052:Pkd1l1 UTSW 11 8947315 missense
R8125:Pkd1l1 UTSW 11 8947241 missense probably damaging 1.00
R8420:Pkd1l1 UTSW 11 8870277 nonsense probably null
R8675:Pkd1l1 UTSW 11 8848916 critical splice donor site probably null
R8683:Pkd1l1 UTSW 11 8871805 missense
R8709:Pkd1l1 UTSW 11 8855567 missense
R8725:Pkd1l1 UTSW 11 8961482 missense
R8733:Pkd1l1 UTSW 11 8933657 missense
R8822:Pkd1l1 UTSW 11 8856312 missense
R8871:Pkd1l1 UTSW 11 8950503 missense
X0024:Pkd1l1 UTSW 11 8950413 missense probably benign 0.01
X0063:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
X0065:Pkd1l1 UTSW 11 8909921 missense probably benign 0.10
Z1176:Pkd1l1 UTSW 11 8826801 missense
Z1177:Pkd1l1 UTSW 11 8945208 missense
Predicted Primers PCR Primer
(F):5'- TCACTGGGATTGGGGTAAATGTAAG -3'
(R):5'- ACCAGAAAGATGGCTCTGTGG -3'

Sequencing Primer
(F):5'- GGAAAGAAGCTTAAGAAATTCACAC -3'
(R):5'- TCTGTGGGAGGGGCACAAAC -3'
Posted On2021-04-30