Incidental Mutation 'R8712:Aqr'
ID669621
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Nameaquarius
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8712 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location114101170-114187024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114118877 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 947 (Y947H)
Ref Sequence ENSEMBL: ENSMUSP00000047157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
Predicted Effect probably damaging
Transcript: ENSMUST00000043160
AA Change: Y947H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: Y947H

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102543
AA Change: Y947H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: Y947H

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A T 16: 85,798,008 N617K probably benign Het
Adnp2 A T 18: 80,130,970 C75S probably damaging Het
Agmo T C 12: 37,357,674 F186L possibly damaging Het
Ahnak2 T C 12: 112,786,252 Y122C Het
Ahnak2 T C 12: 112,787,089 E71G Het
Aldh5a1 A G 13: 24,918,541 V313A probably damaging Het
Ankib1 C A 5: 3,772,643 C21F probably benign Het
Atp1a2 T A 1: 172,275,980 Y991F probably benign Het
Atp8b3 G A 10: 80,530,089 T309M possibly damaging Het
Blzf1 T A 1: 164,298,290 D259V possibly damaging Het
Cacng5 T C 11: 107,881,684 I113V probably benign Het
Catsper3 T C 13: 55,805,844 M269T probably benign Het
Ccdc142 A C 6: 83,102,252 Y190S probably damaging Het
Ccdc159 C A 9: 21,933,755 Q306K probably benign Het
Ccdc180 A T 4: 45,920,842 probably null Het
Cebpz A G 17: 78,921,652 F955S possibly damaging Het
Cftr C T 6: 18,274,697 T938I probably damaging Het
Col28a1 T C 6: 8,013,133 K973R probably benign Het
Cyp2c29 T C 19: 39,321,694 probably benign Het
Ddx1 A G 12: 13,243,858 probably benign Het
Duox2 A C 2: 122,289,345 Y867* probably null Het
Ereg T C 5: 91,089,154 Y111H possibly damaging Het
Esrrb T A 12: 86,518,950 L417Q probably damaging Het
Fbxw7 G A 3: 84,952,377 R2H unknown Het
Galnt6 C T 15: 100,694,620 V569I probably benign Het
Gm14226 G A 2: 155,024,174 C17Y unknown Het
Gpr150 T G 13: 76,056,523 D101A probably damaging Het
Grm1 A T 10: 10,689,552 L1004Q probably benign Het
Gtf2a1l T A 17: 88,714,923 D447E probably damaging Het
Gtf2ird1 C T 5: 134,415,210 V64M probably damaging Het
Ifi206 A T 1: 173,480,508 W641R Het
Ifi214 T A 1: 173,527,920 E107D possibly damaging Het
Kif19a T C 11: 114,784,773 V357A probably damaging Het
Klhdc7b T A 15: 89,386,822 S636T probably benign Het
Klhl25 C T 7: 75,865,672 R109C probably damaging Het
Ltbp2 T C 12: 84,806,350 E835G probably benign Het
March1 A G 8: 66,468,348 K226E probably damaging Het
Mcpt1 T C 14: 56,018,713 probably benign Het
Myrf C A 19: 10,215,070 R639L probably benign Het
Naip5 T C 13: 100,223,096 H544R possibly damaging Het
Nccrp1 T C 7: 28,546,344 I132V probably benign Het
Nprl3 C T 11: 32,237,334 V333I possibly damaging Het
Olfr1318 A T 2: 112,156,589 I213F probably damaging Het
Olfr1385 T A 11: 49,494,844 S104T probably benign Het
Olfr1394 T C 11: 49,160,470 M152T probably benign Het
Olfr300-ps1 T C 7: 86,443,715 S245P probably damaging Het
Olfr32 A T 2: 90,138,770 I123N probably damaging Het
Olfr539 C T 7: 140,668,139 S277L possibly damaging Het
Olfr648 T C 7: 104,179,818 N197D probably damaging Het
Olfr680-ps1 C A 7: 105,092,601 V73F possibly damaging Het
Olfr893 T C 9: 38,209,803 V248A probably benign Het
Olfr974 T C 9: 39,942,595 S112P probably damaging Het
Otx2 A G 14: 48,659,064 M179T probably damaging Het
Ppfia3 T A 7: 45,361,705 T34S probably benign Het
Prkcsh T C 9: 22,013,079 Y502H probably damaging Het
Psd T C 19: 46,313,336 E937G probably damaging Het
Rbbp6 T A 7: 123,001,753 I1661N unknown Het
Rhobtb1 T A 10: 69,270,757 M446K probably damaging Het
Sall3 T C 18: 80,974,021 I231V probably benign Het
Slc12a9 C T 5: 137,327,654 V270I probably damaging Het
Slc6a15 A G 10: 103,389,251 K67E probably damaging Het
Slc9c1 A G 16: 45,560,283 D524G probably benign Het
Smpdl3a A G 10: 57,811,430 D418G probably benign Het
Sox6 T C 7: 115,597,508 T296A probably benign Het
Ssu2 T C 6: 112,384,438 E19G probably damaging Het
Tctn3 T C 19: 40,611,726 N90S probably damaging Het
Tex24 A G 8: 27,344,624 Q60R possibly damaging Het
Tlcd1 T A 11: 78,179,644 *128R probably null Het
Tti1 A C 2: 157,993,010 L1010R probably damaging Het
Ttn A G 2: 76,737,338 L27737P probably damaging Het
Ubqln5 T A 7: 104,129,115 K167N probably benign Het
Unkl A G 17: 25,231,715 I492V possibly damaging Het
Vmn1r8 G A 6: 57,036,680 V239I probably benign Het
Vmn2r101 T A 17: 19,591,135 L494I probably benign Het
Vmn2r54 G T 7: 12,635,950 T62K probably benign Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 114125942 missense possibly damaging 0.90
IGL00694:Aqr APN 2 114151525 missense probably damaging 1.00
IGL02113:Aqr APN 2 114120027 nonsense probably null
IGL02297:Aqr APN 2 114150481 missense probably benign 0.24
IGL02380:Aqr APN 2 114109936 missense probably damaging 1.00
IGL02410:Aqr APN 2 114136917 missense possibly damaging 0.85
IGL02413:Aqr APN 2 114118780 missense possibly damaging 0.87
IGL02474:Aqr APN 2 114112646 missense probably damaging 1.00
IGL02941:Aqr APN 2 114113354 missense probably damaging 1.00
IGL02981:Aqr APN 2 114134824 splice site probably benign
IGL03001:Aqr APN 2 114146919 missense probably benign
IGL03092:Aqr APN 2 114158943 missense probably benign 0.38
IGL03222:Aqr APN 2 114121256 missense probably damaging 1.00
capricorn UTSW 2 114105882 missense probably damaging 1.00
Goat UTSW 2 114157575 missense probably damaging 1.00
Pliades UTSW 2 114132976 missense probably damaging 1.00
sagittarius UTSW 2 114149016 missense probably damaging 1.00
Zodiac UTSW 2 114108109 missense probably damaging 0.96
PIT4531001:Aqr UTSW 2 114130734 missense possibly damaging 0.94
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0152:Aqr UTSW 2 114159010 missense probably benign 0.07
R0352:Aqr UTSW 2 114170052 missense probably damaging 1.00
R0371:Aqr UTSW 2 114157604 missense possibly damaging 0.80
R0374:Aqr UTSW 2 114130611 missense probably damaging 1.00
R0550:Aqr UTSW 2 114132976 missense probably damaging 1.00
R0604:Aqr UTSW 2 114130604 missense probably benign 0.00
R0685:Aqr UTSW 2 114140977 missense probably damaging 1.00
R1236:Aqr UTSW 2 114116655 missense probably damaging 1.00
R1434:Aqr UTSW 2 114150409 missense probably damaging 1.00
R1806:Aqr UTSW 2 114161652 missense probably damaging 1.00
R2154:Aqr UTSW 2 114137004 missense probably damaging 1.00
R2185:Aqr UTSW 2 114130534 critical splice donor site probably null
R2377:Aqr UTSW 2 114140940 missense possibly damaging 0.58
R2862:Aqr UTSW 2 114136917 missense probably damaging 1.00
R3615:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3616:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3713:Aqr UTSW 2 114118669 splice site probably benign
R3715:Aqr UTSW 2 114118669 splice site probably benign
R4586:Aqr UTSW 2 114112577 missense probably benign 0.06
R4663:Aqr UTSW 2 114161666 nonsense probably null
R4809:Aqr UTSW 2 114175214 utr 5 prime probably benign
R4887:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4888:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4952:Aqr UTSW 2 114109937 missense probably damaging 1.00
R4974:Aqr UTSW 2 114113351 missense probably damaging 1.00
R5050:Aqr UTSW 2 114112609 nonsense probably null
R5050:Aqr UTSW 2 114170025 critical splice donor site probably null
R5213:Aqr UTSW 2 114113327 missense probably damaging 1.00
R5263:Aqr UTSW 2 114116578 missense probably damaging 1.00
R5470:Aqr UTSW 2 114157575 missense probably damaging 1.00
R5488:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5489:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5567:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5570:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5641:Aqr UTSW 2 114149034 missense probably damaging 1.00
R5685:Aqr UTSW 2 114156265 missense possibly damaging 0.87
R5963:Aqr UTSW 2 114126961 missense probably damaging 1.00
R5992:Aqr UTSW 2 114143049 nonsense probably null
R6015:Aqr UTSW 2 114175165 start codon destroyed probably null 0.53
R6253:Aqr UTSW 2 114156277 missense possibly damaging 0.93
R6264:Aqr UTSW 2 114109964 missense probably damaging 1.00
R6773:Aqr UTSW 2 114148996 missense possibly damaging 0.64
R6877:Aqr UTSW 2 114116571 nonsense probably null
R7211:Aqr UTSW 2 114134723 missense probably benign 0.01
R7232:Aqr UTSW 2 114105882 missense probably damaging 1.00
R7308:Aqr UTSW 2 114104062 missense possibly damaging 0.86
R7396:Aqr UTSW 2 114119946 nonsense probably null
R7490:Aqr UTSW 2 114158868 critical splice donor site probably null
R7526:Aqr UTSW 2 114108109 missense probably damaging 0.96
R7629:Aqr UTSW 2 114114593 missense probably damaging 1.00
R7828:Aqr UTSW 2 114149016 missense probably damaging 1.00
R8037:Aqr UTSW 2 114161680 missense probably damaging 1.00
R8166:Aqr UTSW 2 114113325 missense possibly damaging 0.95
R8904:Aqr UTSW 2 114136993 missense probably damaging 0.98
Z1176:Aqr UTSW 2 114108122 missense probably damaging 0.98
Z1176:Aqr UTSW 2 114109991 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGCACCCTTCAGCGATTTC -3'
(R):5'- AGAATGGGCTTAATCTCATCAGTG -3'

Sequencing Primer
(F):5'- AGCGATTTCCATGTCTTCCTCATAAG -3'
(R):5'- TAATCTCATCAGTGGCTGCACAGAG -3'
Posted On2021-04-30