Incidental Mutation 'R8712:Olfr974'
ID669652
Institutional Source Beutler Lab
Gene Symbol Olfr974
Ensembl Gene ENSMUSG00000051493
Gene Nameolfactory receptor 974
SynonymsGA_x6K02T2PVTD-33640290-33641222, MOR171-1
Accession Numbers

Genbank: NM_147107

Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8712 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39937501-39945170 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39942595 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 112 (S112P)
Ref Sequence ENSEMBL: ENSMUSP00000149630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062833] [ENSMUST00000213246]
Predicted Effect probably damaging
Transcript: ENSMUST00000062833
AA Change: S112P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062985
Gene: ENSMUSG00000051493
AA Change: S112P

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.6e-52 PFAM
Pfam:7tm_1 41 290 1.3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213246
AA Change: S112P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A T 16: 85,798,008 N617K probably benign Het
Adnp2 A T 18: 80,130,970 C75S probably damaging Het
Agmo T C 12: 37,357,674 F186L possibly damaging Het
Ahnak2 T C 12: 112,786,252 Y122C Het
Ahnak2 T C 12: 112,787,089 E71G Het
Aldh5a1 A G 13: 24,918,541 V313A probably damaging Het
Ankib1 C A 5: 3,772,643 C21F probably benign Het
Aqr A G 2: 114,118,877 Y947H probably damaging Het
Atp1a2 T A 1: 172,275,980 Y991F probably benign Het
Atp8b3 G A 10: 80,530,089 T309M possibly damaging Het
Blzf1 T A 1: 164,298,290 D259V possibly damaging Het
Cacng5 T C 11: 107,881,684 I113V probably benign Het
Catsper3 T C 13: 55,805,844 M269T probably benign Het
Ccdc142 A C 6: 83,102,252 Y190S probably damaging Het
Ccdc159 C A 9: 21,933,755 Q306K probably benign Het
Ccdc180 A T 4: 45,920,842 probably null Het
Cebpz A G 17: 78,921,652 F955S possibly damaging Het
Cftr C T 6: 18,274,697 T938I probably damaging Het
Col28a1 T C 6: 8,013,133 K973R probably benign Het
Cyp2c29 T C 19: 39,321,694 probably benign Het
Ddx1 A G 12: 13,243,858 probably benign Het
Duox2 A C 2: 122,289,345 Y867* probably null Het
Ereg T C 5: 91,089,154 Y111H possibly damaging Het
Esrrb T A 12: 86,518,950 L417Q probably damaging Het
Fbxw7 G A 3: 84,952,377 R2H unknown Het
Galnt6 C T 15: 100,694,620 V569I probably benign Het
Gm14226 G A 2: 155,024,174 C17Y unknown Het
Gpr150 T G 13: 76,056,523 D101A probably damaging Het
Grm1 A T 10: 10,689,552 L1004Q probably benign Het
Gtf2a1l T A 17: 88,714,923 D447E probably damaging Het
Gtf2ird1 C T 5: 134,415,210 V64M probably damaging Het
Ifi206 A T 1: 173,480,508 W641R Het
Ifi214 T A 1: 173,527,920 E107D possibly damaging Het
Kif19a T C 11: 114,784,773 V357A probably damaging Het
Klhdc7b T A 15: 89,386,822 S636T probably benign Het
Klhl25 C T 7: 75,865,672 R109C probably damaging Het
Ltbp2 T C 12: 84,806,350 E835G probably benign Het
March1 A G 8: 66,468,348 K226E probably damaging Het
Mcpt1 T C 14: 56,018,713 probably benign Het
Myrf C A 19: 10,215,070 R639L probably benign Het
Naip5 T C 13: 100,223,096 H544R possibly damaging Het
Nccrp1 T C 7: 28,546,344 I132V probably benign Het
Nprl3 C T 11: 32,237,334 V333I possibly damaging Het
Olfr1318 A T 2: 112,156,589 I213F probably damaging Het
Olfr1385 T A 11: 49,494,844 S104T probably benign Het
Olfr1394 T C 11: 49,160,470 M152T probably benign Het
Olfr300-ps1 T C 7: 86,443,715 S245P probably damaging Het
Olfr32 A T 2: 90,138,770 I123N probably damaging Het
Olfr539 C T 7: 140,668,139 S277L possibly damaging Het
Olfr648 T C 7: 104,179,818 N197D probably damaging Het
Olfr680-ps1 C A 7: 105,092,601 V73F possibly damaging Het
Olfr893 T C 9: 38,209,803 V248A probably benign Het
Otx2 A G 14: 48,659,064 M179T probably damaging Het
Ppfia3 T A 7: 45,361,705 T34S probably benign Het
Prkcsh T C 9: 22,013,079 Y502H probably damaging Het
Psd T C 19: 46,313,336 E937G probably damaging Het
Rbbp6 T A 7: 123,001,753 I1661N unknown Het
Rhobtb1 T A 10: 69,270,757 M446K probably damaging Het
Sall3 T C 18: 80,974,021 I231V probably benign Het
Slc12a9 C T 5: 137,327,654 V270I probably damaging Het
Slc6a15 A G 10: 103,389,251 K67E probably damaging Het
Slc9c1 A G 16: 45,560,283 D524G probably benign Het
Smpdl3a A G 10: 57,811,430 D418G probably benign Het
Sox6 T C 7: 115,597,508 T296A probably benign Het
Ssu2 T C 6: 112,384,438 E19G probably damaging Het
Tctn3 T C 19: 40,611,726 N90S probably damaging Het
Tex24 A G 8: 27,344,624 Q60R possibly damaging Het
Tlcd1 T A 11: 78,179,644 *128R probably null Het
Tti1 A C 2: 157,993,010 L1010R probably damaging Het
Ttn A G 2: 76,737,338 L27737P probably damaging Het
Ubqln5 T A 7: 104,129,115 K167N probably benign Het
Unkl A G 17: 25,231,715 I492V possibly damaging Het
Vmn1r8 G A 6: 57,036,680 V239I probably benign Het
Vmn2r101 T A 17: 19,591,135 L494I probably benign Het
Vmn2r54 G T 7: 12,635,950 T62K probably benign Het
Other mutations in Olfr974
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr974 APN 9 39942680 missense probably benign 0.08
IGL01638:Olfr974 APN 9 39942520 missense probably benign 0.03
IGL02826:Olfr974 APN 9 39942958 missense probably damaging 1.00
IGL03136:Olfr974 APN 9 39943036 missense probably damaging 1.00
H2330:Olfr974 UTSW 9 39942920 missense probably damaging 1.00
R0005:Olfr974 UTSW 9 39942956 missense probably benign
R0106:Olfr974 UTSW 9 39942823 frame shift probably null
R1769:Olfr974 UTSW 9 39942955 missense probably benign 0.43
R1870:Olfr974 UTSW 9 39942821 missense probably damaging 0.99
R4416:Olfr974 UTSW 9 39942428 missense probably damaging 1.00
R4860:Olfr974 UTSW 9 39942504 missense probably benign 0.04
R4860:Olfr974 UTSW 9 39942504 missense probably benign 0.04
R5105:Olfr974 UTSW 9 39942398 missense probably benign 0.19
R5273:Olfr974 UTSW 9 39942557 missense probably benign
R6520:Olfr974 UTSW 9 39942362 missense possibly damaging 0.90
R7203:Olfr974 UTSW 9 39942509 missense probably benign 0.01
R7923:Olfr974 UTSW 9 39942967 nonsense probably null
R8037:Olfr974 UTSW 9 39942881 missense probably damaging 0.98
R8038:Olfr974 UTSW 9 39942881 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGTCTCCATGGCAGGAAAC -3'
(R):5'- TTCCACAGAAGGAACGACTGG -3'

Sequencing Primer
(F):5'- ACCTGGGCTTAGTCTTTTTAATCAG -3'
(R):5'- CGACTGGATATGTAGCTTGTATGAAC -3'
Posted On2021-04-30