Incidental Mutation 'R8712:Slc6a15'
ID 669657
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8712 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 103367783-103419377 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103389251 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 67 (K67E)
Ref Sequence ENSEMBL: ENSMUSP00000073829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636] [ENSMUST00000217905]
AlphaFold Q8BG16
Predicted Effect probably damaging
Transcript: ENSMUST00000074204
AA Change: K67E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: K67E

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179636
AA Change: K67E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: K67E

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217905
AA Change: K67E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A T 16: 85,798,008 N617K probably benign Het
Adnp2 A T 18: 80,130,970 C75S probably damaging Het
Agmo T C 12: 37,357,674 F186L possibly damaging Het
Ahnak2 T C 12: 112,786,252 Y122C Het
Ahnak2 T C 12: 112,787,089 E71G Het
Aldh5a1 A G 13: 24,918,541 V313A probably damaging Het
Ankib1 C A 5: 3,772,643 C21F probably benign Het
Aqr A G 2: 114,118,877 Y947H probably damaging Het
Atp1a2 T A 1: 172,275,980 Y991F probably benign Het
Atp8b3 G A 10: 80,530,089 T309M possibly damaging Het
Blzf1 T A 1: 164,298,290 D259V possibly damaging Het
Cacng5 T C 11: 107,881,684 I113V probably benign Het
Catsper3 T C 13: 55,805,844 M269T probably benign Het
Ccdc142 A C 6: 83,102,252 Y190S probably damaging Het
Ccdc159 C A 9: 21,933,755 Q306K probably benign Het
Ccdc180 A T 4: 45,920,842 probably null Het
Cebpz A G 17: 78,921,652 F955S possibly damaging Het
Cftr C T 6: 18,274,697 T938I probably damaging Het
Col28a1 T C 6: 8,013,133 K973R probably benign Het
Cyp2c29 T C 19: 39,321,694 probably benign Het
Ddx1 A G 12: 13,243,858 probably benign Het
Duox2 A C 2: 122,289,345 Y867* probably null Het
Ereg T C 5: 91,089,154 Y111H possibly damaging Het
Esrrb T A 12: 86,518,950 L417Q probably damaging Het
Fbxw7 G A 3: 84,952,377 R2H unknown Het
Galnt6 C T 15: 100,694,620 V569I probably benign Het
Gm14226 G A 2: 155,024,174 C17Y unknown Het
Gpr150 T G 13: 76,056,523 D101A probably damaging Het
Grm1 A T 10: 10,689,552 L1004Q probably benign Het
Gtf2a1l T A 17: 88,714,923 D447E probably damaging Het
Gtf2ird1 C T 5: 134,415,210 V64M probably damaging Het
Ifi206 A T 1: 173,480,508 W641R Het
Ifi214 T A 1: 173,527,920 E107D possibly damaging Het
Kif19a T C 11: 114,784,773 V357A probably damaging Het
Klhdc7b T A 15: 89,386,822 S636T probably benign Het
Klhl25 C T 7: 75,865,672 R109C probably damaging Het
Ltbp2 T C 12: 84,806,350 E835G probably benign Het
March1 A G 8: 66,468,348 K226E probably damaging Het
Mcpt1 T C 14: 56,018,713 probably benign Het
Myrf C A 19: 10,215,070 R639L probably benign Het
Naip5 T C 13: 100,223,096 H544R possibly damaging Het
Nccrp1 T C 7: 28,546,344 I132V probably benign Het
Nprl3 C T 11: 32,237,334 V333I possibly damaging Het
Olfr1318 A T 2: 112,156,589 I213F probably damaging Het
Olfr1385 T A 11: 49,494,844 S104T probably benign Het
Olfr1394 T C 11: 49,160,470 M152T probably benign Het
Olfr300-ps1 T C 7: 86,443,715 S245P probably damaging Het
Olfr32 A T 2: 90,138,770 I123N probably damaging Het
Olfr539 C T 7: 140,668,139 S277L possibly damaging Het
Olfr648 T C 7: 104,179,818 N197D probably damaging Het
Olfr680-ps1 C A 7: 105,092,601 V73F possibly damaging Het
Olfr893 T C 9: 38,209,803 V248A probably benign Het
Olfr974 T C 9: 39,942,595 S112P probably damaging Het
Otx2 A G 14: 48,659,064 M179T probably damaging Het
Pmfbp1 A G 8: 109,538,677 probably benign Het
Ppfia3 T A 7: 45,361,705 T34S probably benign Het
Prkcsh T C 9: 22,013,079 Y502H probably damaging Het
Psd T C 19: 46,313,336 E937G probably damaging Het
Rbbp6 T A 7: 123,001,753 I1661N unknown Het
Rhobtb1 T A 10: 69,270,757 M446K probably damaging Het
Sall3 T C 18: 80,974,021 I231V probably benign Het
Slc12a9 C T 5: 137,327,654 V270I probably damaging Het
Slc9c1 A G 16: 45,560,283 D524G probably benign Het
Smpdl3a A G 10: 57,811,430 D418G probably benign Het
Sox6 T C 7: 115,597,508 T296A probably benign Het
Ssu2 T C 6: 112,384,438 E19G probably damaging Het
Tctn3 T C 19: 40,611,726 N90S probably damaging Het
Tex24 A G 8: 27,344,624 Q60R possibly damaging Het
Tlcd1 T A 11: 78,179,644 *128R probably null Het
Tti1 A C 2: 157,993,010 L1010R probably damaging Het
Ttn A G 2: 76,737,338 L27737P probably damaging Het
Ubqln5 T A 7: 104,129,115 K167N probably benign Het
Unkl A G 17: 25,231,715 I492V possibly damaging Het
Vmn1r8 G A 6: 57,036,680 V239I probably benign Het
Vmn2r101 T A 17: 19,591,135 L494I probably benign Het
Vmn2r54 G T 7: 12,635,950 T62K probably benign Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103389141 missense probably benign
IGL01320:Slc6a15 APN 10 103404745 missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103404825 splice site probably null
IGL02066:Slc6a15 APN 10 103416658 missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103418222 missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103404275 splice site probably benign
IGL02744:Slc6a15 APN 10 103418033 missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103416680 missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103418068 missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103389347 splice site probably benign
R0165:Slc6a15 UTSW 10 103409809 missense probably null 0.04
R0349:Slc6a15 UTSW 10 103418225 missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103418053 missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103404352 nonsense probably null
R0784:Slc6a15 UTSW 10 103416800 splice site probably benign
R0944:Slc6a15 UTSW 10 103409796 missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103400260 missense probably benign
R1882:Slc6a15 UTSW 10 103395064 missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103409734 missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103393408 missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103416785 missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103404691 missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103418387 missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103393414 missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103409787 missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103418060 missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103404414 missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103389226 missense probably benign
R5320:Slc6a15 UTSW 10 103408206 missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103393508 missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103389170 missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103404367 missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103393914 missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103395067 missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103408302 missense probably benign
R7549:Slc6a15 UTSW 10 103389137 missense probably benign
R7660:Slc6a15 UTSW 10 103393380 splice site probably null
R7839:Slc6a15 UTSW 10 103404799 missense probably benign
R7948:Slc6a15 UTSW 10 103404295 missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103394029 critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103389187 missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103409695 missense possibly damaging 0.68
R8719:Slc6a15 UTSW 10 103404315 missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103389318 missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103393496 missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103395092 nonsense probably null
R9050:Slc6a15 UTSW 10 103416655 missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103400279 missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103393545 nonsense probably null
R9493:Slc6a15 UTSW 10 103393416 missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103404722 missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103404472 missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103400216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCAAGGGTGTCTTTAAGAAG -3'
(R):5'- GAGAATGCAGTAACAATAGGATCTACC -3'

Sequencing Primer
(F):5'- TCCAATGCCTAAGAATAGCAAAGTG -3'
(R):5'- CTGAAATACAGGATTGCCCTTTACGG -3'
Posted On 2021-04-30