Incidental Mutation 'R8712:Nprl3'
ID 669658
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Name nitrogen permease regulator-like 3
Synonyms Mare, HS-26, Prox1, Phg, -14 gene, HS-40, m(alpha)RE
MMRRC Submission 068566-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R8712 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 32181963-32217707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32187334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 333 (V333I)
Ref Sequence ENSEMBL: ENSMUSP00000020530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020528] [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000136903] [ENSMUST00000137950] [ENSMUST00000141859] [ENSMUST00000149526]
AlphaFold Q8VIJ8
Predicted Effect probably benign
Transcript: ENSMUST00000020528
SMART Domains Protein: ENSMUSP00000020528
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:Pur_DNA_glyco 109 304 1.2e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000020530
AA Change: V333I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: V333I

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109389
AA Change: V308I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: V308I

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149526
SMART Domains Protein: ENSMUSP00000122231
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Pfam:NPR3 8 72 2.7e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A T 16: 85,594,896 (GRCm39) N617K probably benign Het
Adnp2 A T 18: 80,174,185 (GRCm39) C75S probably damaging Het
Agmo T C 12: 37,407,673 (GRCm39) F186L possibly damaging Het
Ahnak2 T C 12: 112,749,872 (GRCm39) Y122C Het
Ahnak2 T C 12: 112,750,709 (GRCm39) E71G Het
Aldh5a1 A G 13: 25,102,524 (GRCm39) V313A probably damaging Het
Ankib1 C A 5: 3,822,643 (GRCm39) C21F probably benign Het
Aqr A G 2: 113,949,358 (GRCm39) Y947H probably damaging Het
Atp1a2 T A 1: 172,103,547 (GRCm39) Y991F probably benign Het
Atp8b3 G A 10: 80,365,923 (GRCm39) T309M possibly damaging Het
Blzf1 T A 1: 164,125,859 (GRCm39) D259V possibly damaging Het
Cacng5 T C 11: 107,772,510 (GRCm39) I113V probably benign Het
Catsper3 T C 13: 55,953,657 (GRCm39) M269T probably benign Het
Ccdc142 A C 6: 83,079,233 (GRCm39) Y190S probably damaging Het
Ccdc159 C A 9: 21,845,051 (GRCm39) Q306K probably benign Het
Ccdc180 A T 4: 45,920,842 (GRCm39) probably null Het
Cebpz A G 17: 79,229,081 (GRCm39) F955S possibly damaging Het
Cftr C T 6: 18,274,696 (GRCm39) T938I probably damaging Het
Col28a1 T C 6: 8,013,133 (GRCm39) K973R probably benign Het
Cyp2c29 T C 19: 39,310,138 (GRCm39) probably benign Het
Ddx1 A G 12: 13,293,859 (GRCm39) probably benign Het
Duox2 A C 2: 122,119,826 (GRCm39) Y867* probably null Het
Ereg T C 5: 91,237,013 (GRCm39) Y111H possibly damaging Het
Esrrb T A 12: 86,565,724 (GRCm39) L417Q probably damaging Het
Fbxw7 G A 3: 84,859,684 (GRCm39) R2H unknown Het
Galnt6 C T 15: 100,592,501 (GRCm39) V569I probably benign Het
Gm14226 G A 2: 154,866,094 (GRCm39) C17Y unknown Het
Gpr150 T G 13: 76,204,642 (GRCm39) D101A probably damaging Het
Grm1 A T 10: 10,565,296 (GRCm39) L1004Q probably benign Het
Gtf2a1l T A 17: 89,022,351 (GRCm39) D447E probably damaging Het
Gtf2ird1 C T 5: 134,444,064 (GRCm39) V64M probably damaging Het
Ifi206 A T 1: 173,308,074 (GRCm39) W641R Het
Ifi214 T A 1: 173,355,486 (GRCm39) E107D possibly damaging Het
Kif19a T C 11: 114,675,599 (GRCm39) V357A probably damaging Het
Klhdc7b T A 15: 89,271,025 (GRCm39) S636T probably benign Het
Klhl25 C T 7: 75,515,420 (GRCm39) R109C probably damaging Het
Ltbp2 T C 12: 84,853,124 (GRCm39) E835G probably benign Het
Marchf1 A G 8: 66,921,000 (GRCm39) K226E probably damaging Het
Mcpt1 T C 14: 56,256,170 (GRCm39) probably benign Het
Myrf C A 19: 10,192,434 (GRCm39) R639L probably benign Het
Naip5 T C 13: 100,359,604 (GRCm39) H544R possibly damaging Het
Nccrp1 T C 7: 28,245,769 (GRCm39) I132V probably benign Het
Or13a25 C T 7: 140,248,052 (GRCm39) S277L possibly damaging Het
Or14n1-ps1 T C 7: 86,092,923 (GRCm39) S245P probably damaging Het
Or2o1 T C 11: 49,051,297 (GRCm39) M152T probably benign Het
Or2y1 T A 11: 49,385,671 (GRCm39) S104T probably benign Het
Or4b1d A T 2: 89,969,114 (GRCm39) I123N probably damaging Het
Or4f62 A T 2: 111,986,934 (GRCm39) I213F probably damaging Het
Or52h1 T C 7: 103,829,025 (GRCm39) N197D probably damaging Het
Or56a41 C A 7: 104,741,808 (GRCm39) V73F possibly damaging Het
Or8c15 T C 9: 38,121,099 (GRCm39) V248A probably benign Het
Or8d6 T C 9: 39,853,891 (GRCm39) S112P probably damaging Het
Otx2 A G 14: 48,896,521 (GRCm39) M179T probably damaging Het
Pmfbp1 A G 8: 110,265,309 (GRCm39) probably benign Het
Ppfia3 T A 7: 45,011,129 (GRCm39) T34S probably benign Het
Prkcsh T C 9: 21,924,375 (GRCm39) Y502H probably damaging Het
Psd T C 19: 46,301,775 (GRCm39) E937G probably damaging Het
Rbbp6 T A 7: 122,600,976 (GRCm39) I1661N unknown Het
Rhobtb1 T A 10: 69,106,587 (GRCm39) M446K probably damaging Het
Sall3 T C 18: 81,017,236 (GRCm39) I231V probably benign Het
Slc12a9 C T 5: 137,325,916 (GRCm39) V270I probably damaging Het
Slc6a15 A G 10: 103,225,112 (GRCm39) K67E probably damaging Het
Slc9c1 A G 16: 45,380,646 (GRCm39) D524G probably benign Het
Smpdl3a A G 10: 57,687,526 (GRCm39) D418G probably benign Het
Sox6 T C 7: 115,196,743 (GRCm39) T296A probably benign Het
Ssu2 T C 6: 112,361,399 (GRCm39) E19G probably damaging Het
Tctn3 T C 19: 40,600,170 (GRCm39) N90S probably damaging Het
Tex24 A G 8: 27,834,652 (GRCm39) Q60R possibly damaging Het
Tlcd1 T A 11: 78,070,470 (GRCm39) *128R probably null Het
Tti1 A C 2: 157,834,930 (GRCm39) L1010R probably damaging Het
Ttn A G 2: 76,567,682 (GRCm39) L27737P probably damaging Het
Ubqln5 T A 7: 103,778,322 (GRCm39) K167N probably benign Het
Unkl A G 17: 25,450,689 (GRCm39) I492V possibly damaging Het
Vmn1r8 G A 6: 57,013,665 (GRCm39) V239I probably benign Het
Vmn2r101 T A 17: 19,811,397 (GRCm39) L494I probably benign Het
Vmn2r54 G T 7: 12,369,877 (GRCm39) T62K probably benign Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32,217,539 (GRCm39) start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32,198,230 (GRCm39) intron probably benign
IGL03366:Nprl3 APN 11 32,200,256 (GRCm39) missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32,189,784 (GRCm39) unclassified probably benign
R0555:Nprl3 UTSW 11 32,183,118 (GRCm39) critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32,184,876 (GRCm39) missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32,182,973 (GRCm39) missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32,184,894 (GRCm39) missense probably benign 0.00
R2884:Nprl3 UTSW 11 32,198,163 (GRCm39) missense probably damaging 1.00
R3713:Nprl3 UTSW 11 32,205,464 (GRCm39) missense probably damaging 0.98
R3836:Nprl3 UTSW 11 32,183,082 (GRCm39) missense probably damaging 1.00
R4354:Nprl3 UTSW 11 32,184,906 (GRCm39) missense probably benign 0.00
R6052:Nprl3 UTSW 11 32,205,453 (GRCm39) missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32,217,432 (GRCm39) missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32,189,828 (GRCm39) missense probably damaging 1.00
R6553:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6585:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6774:Nprl3 UTSW 11 32,187,381 (GRCm39) missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32,217,509 (GRCm39) missense probably damaging 0.99
R7746:Nprl3 UTSW 11 32,198,150 (GRCm39) nonsense probably null
R7980:Nprl3 UTSW 11 32,187,357 (GRCm39) missense probably damaging 1.00
R8483:Nprl3 UTSW 11 32,213,083 (GRCm39) missense probably damaging 1.00
R8827:Nprl3 UTSW 11 32,184,742 (GRCm39) missense probably benign 0.00
R9264:Nprl3 UTSW 11 32,183,948 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGAGCACGATATGGGCAG -3'
(R):5'- AGAGAATGCTGTGCTTCTGCTG -3'

Sequencing Primer
(F):5'- CACGATATGGGCAGGCAGC -3'
(R):5'- CTGTGCTTCTGCTGGAGCC -3'
Posted On 2021-04-30