Incidental Mutation 'R8712:Naip5'
ID 669673
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene Name NLR family, apoptosis inhibitory protein 5
Synonyms Birc1e, Lgn1, Naip-rs3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R8712 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 100211739-100246323 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100223096 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 544 (H544R)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
AlphaFold Q9R016
Predicted Effect possibly damaging
Transcript: ENSMUST00000049789
AA Change: H544R

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: H544R

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A T 16: 85,798,008 N617K probably benign Het
Adnp2 A T 18: 80,130,970 C75S probably damaging Het
Agmo T C 12: 37,357,674 F186L possibly damaging Het
Ahnak2 T C 12: 112,786,252 Y122C Het
Ahnak2 T C 12: 112,787,089 E71G Het
Aldh5a1 A G 13: 24,918,541 V313A probably damaging Het
Ankib1 C A 5: 3,772,643 C21F probably benign Het
Aqr A G 2: 114,118,877 Y947H probably damaging Het
Atp1a2 T A 1: 172,275,980 Y991F probably benign Het
Atp8b3 G A 10: 80,530,089 T309M possibly damaging Het
Blzf1 T A 1: 164,298,290 D259V possibly damaging Het
Cacng5 T C 11: 107,881,684 I113V probably benign Het
Catsper3 T C 13: 55,805,844 M269T probably benign Het
Ccdc142 A C 6: 83,102,252 Y190S probably damaging Het
Ccdc159 C A 9: 21,933,755 Q306K probably benign Het
Ccdc180 A T 4: 45,920,842 probably null Het
Cebpz A G 17: 78,921,652 F955S possibly damaging Het
Cftr C T 6: 18,274,697 T938I probably damaging Het
Col28a1 T C 6: 8,013,133 K973R probably benign Het
Cyp2c29 T C 19: 39,321,694 probably benign Het
Ddx1 A G 12: 13,243,858 probably benign Het
Duox2 A C 2: 122,289,345 Y867* probably null Het
Ereg T C 5: 91,089,154 Y111H possibly damaging Het
Esrrb T A 12: 86,518,950 L417Q probably damaging Het
Fbxw7 G A 3: 84,952,377 R2H unknown Het
Galnt6 C T 15: 100,694,620 V569I probably benign Het
Gm14226 G A 2: 155,024,174 C17Y unknown Het
Gpr150 T G 13: 76,056,523 D101A probably damaging Het
Grm1 A T 10: 10,689,552 L1004Q probably benign Het
Gtf2a1l T A 17: 88,714,923 D447E probably damaging Het
Gtf2ird1 C T 5: 134,415,210 V64M probably damaging Het
Ifi206 A T 1: 173,480,508 W641R Het
Ifi214 T A 1: 173,527,920 E107D possibly damaging Het
Kif19a T C 11: 114,784,773 V357A probably damaging Het
Klhdc7b T A 15: 89,386,822 S636T probably benign Het
Klhl25 C T 7: 75,865,672 R109C probably damaging Het
Ltbp2 T C 12: 84,806,350 E835G probably benign Het
March1 A G 8: 66,468,348 K226E probably damaging Het
Mcpt1 T C 14: 56,018,713 probably benign Het
Myrf C A 19: 10,215,070 R639L probably benign Het
Nccrp1 T C 7: 28,546,344 I132V probably benign Het
Nprl3 C T 11: 32,237,334 V333I possibly damaging Het
Olfr1318 A T 2: 112,156,589 I213F probably damaging Het
Olfr1385 T A 11: 49,494,844 S104T probably benign Het
Olfr1394 T C 11: 49,160,470 M152T probably benign Het
Olfr300-ps1 T C 7: 86,443,715 S245P probably damaging Het
Olfr32 A T 2: 90,138,770 I123N probably damaging Het
Olfr539 C T 7: 140,668,139 S277L possibly damaging Het
Olfr648 T C 7: 104,179,818 N197D probably damaging Het
Olfr680-ps1 C A 7: 105,092,601 V73F possibly damaging Het
Olfr893 T C 9: 38,209,803 V248A probably benign Het
Olfr974 T C 9: 39,942,595 S112P probably damaging Het
Otx2 A G 14: 48,659,064 M179T probably damaging Het
Pmfbp1 A G 8: 109,538,677 probably benign Het
Ppfia3 T A 7: 45,361,705 T34S probably benign Het
Prkcsh T C 9: 22,013,079 Y502H probably damaging Het
Psd T C 19: 46,313,336 E937G probably damaging Het
Rbbp6 T A 7: 123,001,753 I1661N unknown Het
Rhobtb1 T A 10: 69,270,757 M446K probably damaging Het
Sall3 T C 18: 80,974,021 I231V probably benign Het
Slc12a9 C T 5: 137,327,654 V270I probably damaging Het
Slc6a15 A G 10: 103,389,251 K67E probably damaging Het
Slc9c1 A G 16: 45,560,283 D524G probably benign Het
Smpdl3a A G 10: 57,811,430 D418G probably benign Het
Sox6 T C 7: 115,597,508 T296A probably benign Het
Ssu2 T C 6: 112,384,438 E19G probably damaging Het
Tctn3 T C 19: 40,611,726 N90S probably damaging Het
Tex24 A G 8: 27,344,624 Q60R possibly damaging Het
Tlcd1 T A 11: 78,179,644 *128R probably null Het
Tti1 A C 2: 157,993,010 L1010R probably damaging Het
Ttn A G 2: 76,737,338 L27737P probably damaging Het
Ubqln5 T A 7: 104,129,115 K167N probably benign Het
Unkl A G 17: 25,231,715 I492V possibly damaging Het
Vmn1r8 G A 6: 57,036,680 V239I probably benign Het
Vmn2r101 T A 17: 19,591,135 L494I probably benign Het
Vmn2r54 G T 7: 12,635,950 T62K probably benign Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood2 UTSW 13 100223014 nonsense probably null
inwood3 UTSW 13 100221903 nonsense probably null
Nuchal UTSW 13 100214663 missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0462:Naip5 UTSW 13 100221732 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0674:Naip5 UTSW 13 100223199 missense probably benign 0.04
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1302:Naip5 UTSW 13 100221591 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100222206 missense probably benign
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R1972:Naip5 UTSW 13 100212770 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3723:Naip5 UTSW 13 100223014 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100221870 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100223406 missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100245662 missense probably benign 0.08
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5760:Naip5 UTSW 13 100242838 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
R7447:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7447:Naip5 UTSW 13 100219697 missense not run
R7466:Naip5 UTSW 13 100221986 nonsense probably null
R7491:Naip5 UTSW 13 100217071 missense probably benign 0.18
R7559:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7559:Naip5 UTSW 13 100219697 missense not run
R7562:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7562:Naip5 UTSW 13 100219697 missense not run
R7588:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7588:Naip5 UTSW 13 100219697 missense not run
R7589:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7589:Naip5 UTSW 13 100219697 missense not run
R7590:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7590:Naip5 UTSW 13 100219697 missense not run
R7742:Naip5 UTSW 13 100219830 missense probably benign
R7886:Naip5 UTSW 13 100246181 missense probably benign 0.28
R7996:Naip5 UTSW 13 100221656 missense probably damaging 1.00
R8026:Naip5 UTSW 13 100245898 missense probably damaging 1.00
R8046:Naip5 UTSW 13 100222233 missense probably benign
R8319:Naip5 UTSW 13 100221659 missense probably benign 0.12
R8471:Naip5 UTSW 13 100221645 missense probably damaging 0.99
R8480:Naip5 UTSW 13 100222235 missense probably damaging 1.00
R8496:Naip5 UTSW 13 100212739 missense probably benign 0.00
R8500:Naip5 UTSW 13 100222712 missense probably damaging 0.98
R8780:Naip5 UTSW 13 100219830 missense probably benign
R8781:Naip5 UTSW 13 100219830 missense probably benign
R8788:Naip5 UTSW 13 100219830 missense probably benign
R8817:Naip5 UTSW 13 100212699 missense probably benign 0.01
R8833:Naip5 UTSW 13 100222934 missense probably damaging 0.97
R8835:Naip5 UTSW 13 100219830 missense probably benign
R8958:Naip5 UTSW 13 100217609 nonsense probably null
R9031:Naip5 UTSW 13 100219830 missense probably benign
R9032:Naip5 UTSW 13 100219830 missense probably benign
R9074:Naip5 UTSW 13 100221756 missense possibly damaging 0.92
R9098:Naip5 UTSW 13 100229619 missense possibly damaging 0.67
R9204:Naip5 UTSW 13 100222500 missense probably damaging 1.00
R9223:Naip5 UTSW 13 100227676 missense probably benign 0.05
R9358:Naip5 UTSW 13 100219830 missense probably benign
R9389:Naip5 UTSW 13 100219830 missense probably benign
R9403:Naip5 UTSW 13 100219830 missense probably benign
R9518:Naip5 UTSW 13 100221859 missense probably benign
R9568:Naip5 UTSW 13 100219830 missense probably benign
R9568:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9569:Naip5 UTSW 13 100219830 missense probably benign
R9569:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9570:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9572:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9581:Naip5 UTSW 13 100214686 missense probably benign 0.11
R9627:Naip5 UTSW 13 100219830 missense probably benign
R9725:Naip5 UTSW 13 100222276 missense possibly damaging 0.94
R9763:Naip5 UTSW 13 100230761 missense probably damaging 0.99
R9764:Naip5 UTSW 13 100230761 missense probably damaging 0.99
R9765:Naip5 UTSW 13 100230761 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATAGAAGGGAAACTCTTGGATCTCTAG -3'
(R):5'- CTGGCAGTGGAAAGACAACC -3'

Sequencing Primer
(F):5'- GGAAACTCTTGGATCTCTAGACTTG -3'
(R):5'- TCCTGAAGAGGATAGCTTTTCTC -3'
Posted On 2021-04-30