Incidental Mutation 'R8712:Slc9c1'
ID 669678
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 068566-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R8712 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45380646 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 524 (D524G)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: D524G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: D524G

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A T 16: 85,594,896 (GRCm39) N617K probably benign Het
Adnp2 A T 18: 80,174,185 (GRCm39) C75S probably damaging Het
Agmo T C 12: 37,407,673 (GRCm39) F186L possibly damaging Het
Ahnak2 T C 12: 112,749,872 (GRCm39) Y122C Het
Ahnak2 T C 12: 112,750,709 (GRCm39) E71G Het
Aldh5a1 A G 13: 25,102,524 (GRCm39) V313A probably damaging Het
Ankib1 C A 5: 3,822,643 (GRCm39) C21F probably benign Het
Aqr A G 2: 113,949,358 (GRCm39) Y947H probably damaging Het
Atp1a2 T A 1: 172,103,547 (GRCm39) Y991F probably benign Het
Atp8b3 G A 10: 80,365,923 (GRCm39) T309M possibly damaging Het
Blzf1 T A 1: 164,125,859 (GRCm39) D259V possibly damaging Het
Cacng5 T C 11: 107,772,510 (GRCm39) I113V probably benign Het
Catsper3 T C 13: 55,953,657 (GRCm39) M269T probably benign Het
Ccdc142 A C 6: 83,079,233 (GRCm39) Y190S probably damaging Het
Ccdc159 C A 9: 21,845,051 (GRCm39) Q306K probably benign Het
Ccdc180 A T 4: 45,920,842 (GRCm39) probably null Het
Cebpz A G 17: 79,229,081 (GRCm39) F955S possibly damaging Het
Cftr C T 6: 18,274,696 (GRCm39) T938I probably damaging Het
Col28a1 T C 6: 8,013,133 (GRCm39) K973R probably benign Het
Cyp2c29 T C 19: 39,310,138 (GRCm39) probably benign Het
Ddx1 A G 12: 13,293,859 (GRCm39) probably benign Het
Duox2 A C 2: 122,119,826 (GRCm39) Y867* probably null Het
Ereg T C 5: 91,237,013 (GRCm39) Y111H possibly damaging Het
Esrrb T A 12: 86,565,724 (GRCm39) L417Q probably damaging Het
Fbxw7 G A 3: 84,859,684 (GRCm39) R2H unknown Het
Galnt6 C T 15: 100,592,501 (GRCm39) V569I probably benign Het
Gm14226 G A 2: 154,866,094 (GRCm39) C17Y unknown Het
Gpr150 T G 13: 76,204,642 (GRCm39) D101A probably damaging Het
Grm1 A T 10: 10,565,296 (GRCm39) L1004Q probably benign Het
Gtf2a1l T A 17: 89,022,351 (GRCm39) D447E probably damaging Het
Gtf2ird1 C T 5: 134,444,064 (GRCm39) V64M probably damaging Het
Ifi206 A T 1: 173,308,074 (GRCm39) W641R Het
Ifi214 T A 1: 173,355,486 (GRCm39) E107D possibly damaging Het
Kif19a T C 11: 114,675,599 (GRCm39) V357A probably damaging Het
Klhdc7b T A 15: 89,271,025 (GRCm39) S636T probably benign Het
Klhl25 C T 7: 75,515,420 (GRCm39) R109C probably damaging Het
Ltbp2 T C 12: 84,853,124 (GRCm39) E835G probably benign Het
Marchf1 A G 8: 66,921,000 (GRCm39) K226E probably damaging Het
Mcpt1 T C 14: 56,256,170 (GRCm39) probably benign Het
Myrf C A 19: 10,192,434 (GRCm39) R639L probably benign Het
Naip5 T C 13: 100,359,604 (GRCm39) H544R possibly damaging Het
Nccrp1 T C 7: 28,245,769 (GRCm39) I132V probably benign Het
Nprl3 C T 11: 32,187,334 (GRCm39) V333I possibly damaging Het
Or13a25 C T 7: 140,248,052 (GRCm39) S277L possibly damaging Het
Or14n1-ps1 T C 7: 86,092,923 (GRCm39) S245P probably damaging Het
Or2o1 T C 11: 49,051,297 (GRCm39) M152T probably benign Het
Or2y1 T A 11: 49,385,671 (GRCm39) S104T probably benign Het
Or4b1d A T 2: 89,969,114 (GRCm39) I123N probably damaging Het
Or4f62 A T 2: 111,986,934 (GRCm39) I213F probably damaging Het
Or52h1 T C 7: 103,829,025 (GRCm39) N197D probably damaging Het
Or56a41 C A 7: 104,741,808 (GRCm39) V73F possibly damaging Het
Or8c15 T C 9: 38,121,099 (GRCm39) V248A probably benign Het
Or8d6 T C 9: 39,853,891 (GRCm39) S112P probably damaging Het
Otx2 A G 14: 48,896,521 (GRCm39) M179T probably damaging Het
Pmfbp1 A G 8: 110,265,309 (GRCm39) probably benign Het
Ppfia3 T A 7: 45,011,129 (GRCm39) T34S probably benign Het
Prkcsh T C 9: 21,924,375 (GRCm39) Y502H probably damaging Het
Psd T C 19: 46,301,775 (GRCm39) E937G probably damaging Het
Rbbp6 T A 7: 122,600,976 (GRCm39) I1661N unknown Het
Rhobtb1 T A 10: 69,106,587 (GRCm39) M446K probably damaging Het
Sall3 T C 18: 81,017,236 (GRCm39) I231V probably benign Het
Slc12a9 C T 5: 137,325,916 (GRCm39) V270I probably damaging Het
Slc6a15 A G 10: 103,225,112 (GRCm39) K67E probably damaging Het
Smpdl3a A G 10: 57,687,526 (GRCm39) D418G probably benign Het
Sox6 T C 7: 115,196,743 (GRCm39) T296A probably benign Het
Ssu2 T C 6: 112,361,399 (GRCm39) E19G probably damaging Het
Tctn3 T C 19: 40,600,170 (GRCm39) N90S probably damaging Het
Tex24 A G 8: 27,834,652 (GRCm39) Q60R possibly damaging Het
Tlcd1 T A 11: 78,070,470 (GRCm39) *128R probably null Het
Tti1 A C 2: 157,834,930 (GRCm39) L1010R probably damaging Het
Ttn A G 2: 76,567,682 (GRCm39) L27737P probably damaging Het
Ubqln5 T A 7: 103,778,322 (GRCm39) K167N probably benign Het
Unkl A G 17: 25,450,689 (GRCm39) I492V possibly damaging Het
Vmn1r8 G A 6: 57,013,665 (GRCm39) V239I probably benign Het
Vmn2r101 T A 17: 19,811,397 (GRCm39) L494I probably benign Het
Vmn2r54 G T 7: 12,369,877 (GRCm39) T62K probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGAGGCCACCTAAGCAAATG -3'
(R):5'- CCTTTGTGCTAGCATGCTTG -3'

Sequencing Primer
(F):5'- GCGATTGGCTATCTTTATATACCCG -3'
(R):5'- GCTAGCATGCTTGTGTTGAG -3'
Posted On 2021-04-30